Prev. |  KEGG KO K18038 > 

RIKEN DNA Bank Human Resource - PTPN9

Gene ID NCBI Gene 5780 |  KEGG hsa:5780
Gene Symbol PTPN9
Protein Name protein tyrosine phosphatase, non-receptor type 9
Synonyms MEG2|PTPMEG2
Ortholog resources KEGG ortholog (KEGG orthology K18038) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005779 IRAK014H11 pCMV-SPORT6 BC010863 NM_002833 Full
HGY067170 IRAK167P10 pBluescriptR BC071574 NM_002833 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR191727 ARi79F07 pGCAP10 NM_002833.2  
GGTGGCGCTGTGGAGGAGCGGGAGCGCGGCCGAGGAAGCGGGGCGCCGAGGGGGTCGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl