Prev. |  KEGG KO K16642 > 

RIKEN DNA Bank Human Resource - PTN

Gene ID NCBI Gene 5764 |  KEGG hsa:5764
Gene Symbol PTN
Protein Name pleiotrophin
Synonyms HARP|HB-GAM|HBBM|HBGF-8|HBGF8|HBNF|HBNF-1|NEGF1|OSF-1
Ortholog resource in our bank

  PTN

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01329 pST26 Human, pleiotrophin (PTN), HB-GAM, HBGF-8, HBNF, MK family, cDNA

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088694 IRAL021M06 pDNR-LIB BC005916 NM_002825 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR049375 ARe23H07 pKA1U5 NM_002825.5  
GGGACTCAGCGGTAGCAACCTCGCCCCTTGCAACAAATGCAGACTGAGCGCCAGAGAGGA
HKR209529 ARiS023N17 pGCAP10 NM_002825.5  
GAGGAGCTGCAGCGAGCCGGGTACCTGGACTCAGCGGTAGCAACCTCGCCCCTTGCAACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.08.17

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl