DNA Bank Top |  KEGG KO K16642 > 

RIKEN DNA Bank Human Resource - PTN

Gene ID NCBI Gene 5764 |  KEGG hsa:5764
Gene Symbol PTN
Protein Name pleiotrophin
Synonyms HARP|HB-GAM|HBBM|HBGF-8|HBGF8|HBNF|HBNF-1|NEGF1|OSF-1

Link

Ortholog resource in our bank

  PTN


External database

human PTN

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB01329 pST26 Human, pleiotrophin (PTN), HB-GAM, HBGF-8, HBNF, MK family, cDNA    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088694 IRAL021M06 pDNR-LIB BC005916 NM_002825 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR049375 ARe23H07 pKA1U5 NM_002825.5  
GGGACTCAGCGGTAGCAACCTCGCCCCTTGCAACAAATGCAGACTGAGCGCCAGAGAGGA
HKR209529 ARiS023N17 pGCAP10 NM_002825.5  
GAGGAGCTGCAGCGAGCCGGGTACCTGGACTCAGCGGTAGCAACCTCGCCCCTTGCAACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.01

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl