Prev. |  KEGG KO K13784 > 

RIKEN DNA Bank Human Resource - PTMA

Gene ID NCBI Gene 5757 |  KEGG hsa:5757
Gene Symbol PTMA
Protein Name prothymosin, alpha
Synonyms TMSA
Ortholog resources KEGG ortholog (KEGG orthology K13784) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX066525 IRAK166F05 pCMV-SPORT6 BC071647 NM_002823 Full/var
HGY066981 IRAK167H13 pBluescriptR BC066905 NM_002823 Full/var
HGX069945 IRAK174O09 pCMV-SPORT6 BC070480 NM_002823 Full/var
HGY085219 IRAL013A19 pOTB7 BC003510 NM_002823 Full/var
HGY094221 IRAL035J05 pDNR-LIB BC022433 NM_002823 Full
HGY097276 IRAL043D04 pOTB7 BC034921 NM_002823 Full/var
HGY098823 IRAL047A23 pOTB7 BC051265 NM_002823 Full/var
HGY103511 IRAL058M23 pOTB7 BC071879 NM_002823 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE086030 M01C015B06 pDONR221 FLJ05-D03 BC051265 NM_002823  
HGE086078 M01C015D06 pDONR221 FLJ05-D03 BC051265 NM_002823  
HGE086126 M01C015F06 pDONR221 FLJ05-D03 BC051265 NM_002823  
HGE086174 M01C015H06 pDONR221 FLJ05-D03 BC051265 NM_002823  
HGE086222 M01C015J06 pDONR221 FLJ05-D03 BC051265 NM_002823  
HGE086270 M01C015L06 pDONR221 FLJ05-D03 BC051265 NM_002823  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041278 ARe03D06 pKA1U5 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTTCCTCATCCGCCTCCTTGCTC
HKR041303 ARe03E07 pKA1U5 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR042152 ARe05G08 pKA1U5 NM_002823.4  
GTGCCCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTT
HKR042973 ARe07H05 pKA1U5 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR043779 ARe09H11 pKA1U5 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR050178 ARe25H10 pKA1U5 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR051302 ARe28E06 pKA1U5 NM_002823.4  
ACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGCA
HKR051375 ARe28H07 pKA1U5 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR052428 ARe31B04 pKA1U5 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR052432 ARe31B08 pKA1U5 NM_002823.4  
GCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGC
HKR053282 ARe33D10 pKA1U5 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR053708 ARe34E12 pKA1U5 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCNTTNTTTCCTCATCCGCCTCCTTGCTC
HKR054474 ARe36D02 pKA1U5 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR055347 ARe38G03 pKA1U5 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGCTTCTTCATCCGCCTCCTTGCTCGCCG
HKR055770 ARe39H02 pKA1U5 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR056452 ARe41C04 pKA1U5 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR057770 ARe44H02 pKA1U5 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGCNTCTTCATCCGCCTCCTTGCTCGCCG
HKR060032 ARe50B08 pKA1U5 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR060803 ARe52A03 pKA1U5 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCNTTGTTTCCTCATCCGCCTCCTTGCTC
HKR060825 ARe52B01 pKA1U5 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGCTTCCTCATCCGCCTCCTTGCTCGCCG
HKR062179 ARe55H11 pKA1U5 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGCNTCTTCAGTCCGCCTCCTTGCTCGCC
HKR063280 ARe58D08 pKA1U5 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR064078 ARe60D06 pKA1U5 NM_002823.4  
GCCCACTGGCCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR065209 ARe63A09 pKA1U5 NM_002823.4  
GCCCCACNGGCTGCTCTGAAAAGCCATCTTNCGCATCCGTTCCTCATCCGCCTACCTNNG
HKR066503 ARe66E07 pKA1U5 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR068052 ARe70C04 pKA1U5 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCATNTGNATTGCCCNTTAAANCGCCTCCTTGNTCGCC
HKR069260 ARe73C12 pKA1U5 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR069702 ARe74E06 pKA1U5 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTTCCTCATCCGCCTCCTTGCTC
HKR072802 ARe82A02 pKA1U5 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR073307 ARe83E11 pKA1U5 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR074121 ARe85F01 pKA1U5 NM_002823.4  
GCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGC
HKR076056 ARe90C08 pKA1U5 NM_002823.4  
GCCCCACTGGCCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR076498 ARe91E02 pKA1U5 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR076955 ARe92G11 pKA1U5 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR077323 ARe93F03 pKA1U5 NM_002823.4  
TCTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGCA
HKR079204 ARe98A04 pKA1U5 NM_002823.4  
GCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGC
HKR079778 ARe99H10 pKA1U5 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR081303 ARf03E07 pKA1U5 NM_002823.4  
GCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGC
HKR082124 ARf05F04 pKA1U5 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR082502 ARf06E06 pKA1U5 NM_002823.4  
GCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGC
HKR082803 ARf07A03 pKA1U5 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR161354 ARi03G10 pGCAP10 NM_002823.4  
HKR162401 ARi06A01 pGCAP10 NM_002823.4  
GACTNNGCTGCTCCTGAAAAGCCATCTTTNGCATTCGTTCCTCATCCGCCTCCTTAGCTC
HKR164033 ARi10B09 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR165610 ARi14A10 pGCAP10 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR169284 ARi23D12 pGCAP10 NM_002823.4  
CGGCCGGCCGATGCTCTCTTCCTTTCTCCGCCATCGTGGTGTGTTCTTGACTCCGCTGCT
HKR172856 ARi32C08 pGCAP10 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR176924 ARi42F04 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR177625 ARi44B01 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR179355 ARi48G11 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR179660 ARi49C12 pGCAP10 NM_002823.4  
CGGCCGGCCGATGATCCGCCTCCTTGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCCTCC
HKR182577 ARi56H09 pGCAP10 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR185322 ARi63F02 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR185370 ARi63H02 pGCAP10 NM_002823.4  
GATCCGCCTCCTTGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCCTCCGCCGCCGCGGAC
HKR186483 ARi66D11 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR203352 ARiS008G08 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR208105 ARiS020E09 pGCAP10 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR209424 ARiS023J08 pGCAP10 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR218142 ARiS045F22 pGCAP10 NM_002823.4  
GGNCCNCNNNNTGNNCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR218263 ARiS045K23 pGCAP10 NM_002823.4  
GCCCCACTGGCTGCTCTGAAANNCCNTCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR218296 ARiS045M08 pGCAP10 NM_002823.4  
GCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCC
HKR218334 ARiS045N22 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR218344 ARiS045O08 pGCAP10 NM_002823.4  
CGGCCGGCCGATGACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTC
HKR218376 ARiS045P16 pGCAP10 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR234966 ARiS087G22 pGCAP10 NM_002823.4  
HKR235574 ARiS088P14 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR238693 ARiS096M05 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR243722 ARiS109F02 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR243822 ARiS109J06 pGCAP10 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR247289 ARiS118D17 pGCAP10 NM_002823.4  
AGCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCT
HKR248848 ARiS122B24 pGCAP10 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR249128 ARiS122N16 pGCAP10 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR260366 ARiS150P06 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR264424 ARiS161A24 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR276608 ARiS191I16 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR279539 ARiS198O03 pGCAP10 NM_002823.4  
TGCCCCCACNGGNNGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCT
HKR320548 RBb01G04 pKA1U5 NM_002823.4  
GCCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCT
HKR321207 RBb03A07 pKA1U5 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR321770 RBb04H02 pKA1U5 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCCTTNTTCCTCATCCGCCTCCTTGCTCG
HKR322409 RBb06A09 pKA1U5 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR323652 RBb09C04 pKA1U5 NM_002823.4  
GCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGC
HKR324131 RBb10F11 pKA1U5 NM_002823.4  
TGACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCG
HKR324429 RBb11B05 pKA1U5 NM_002823.4  
GCCCCACTGGCCTGCTCTGAAAAGCCATCTTTGCATTGTTTCCTCATCCGCCTCCTTGCT
HKR324546 RBb11G02 pKA1U5 NM_002823.4  
HKR324569 RBb11H01 pKA1U5 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR324947 RBb12G03 pKA1U5 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR324977 RBb12H09 pKA1U5 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR325679 RBb14D07 pKA1U5 NM_002823.4  
GCCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCT
HKR328003 RBb20A03 pKA1U5 NM_002823.4  
TGCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCT
HKR328175 RBb20H07 pKA1U5 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR328532 RBb21F12 pKA1U5 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR329330 RBb23F10 pGCAP1 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR330049 RBb25C01 pGCAP1 NM_002823.4  
GCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGC
HKR331300 RBb28E04 pGCAP1 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR331626 RBb29B02 pGCAP1 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR331721 RBb29F01 pGCAP1 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR332457 RBb31C09 pGCAP1 NM_002823.4  
HKR332851 RBb32C03 pGCAP1 NM_002823.4  
GCCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTTCCTCATCCGCCTCCTTGC
HKR332949 RBb32G05 pGCAP1 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR334552 RBb36G08 pGCAP1 NM_002823.4  
TGCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR334858 RBb37C10 pGCAP1 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR334929 RBb37F09 pGCAP1 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR334969 RBb37H01 pGCAP1 NM_002823.4  
GCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGC
HKR335324 RBb38F04 pGCAP1 NM_002823.4  
ATGGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCCTCCGCCGCCGCGGACTCCGGCAGCT
HKR336498 RBb41E02 pGCAP1 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR336802 RBb42A02 pGCAP1 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR336951 RBb42G07 pGCAP1 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR337256 RBb43C08 pGCAP1 NM_002823.4  
TGCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR337602 RBb44A02 pGCAP1 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR338480 RBb46D08 pGCAP1 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR338572 RBb46H04 pGCAP1 NM_002823.4  
TGTCTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCG
HKR338977 RBb47H09 pGCAP1 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR339708 RBb49E12 pGCAP1 NM_002823.4  
TTGCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCT
HKR340428 RBb51B04 pGCAP1 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR340873 RBb52D01 pGCAP1 NM_002823.4  
GCCCCACTGGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR341255 RBb53C07 pGCAP1 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR341303 RBb53E07 pGCAP1 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGGTTCCTCATCCGCCTCCTTGCT
HKR341747 RBb54G03 pGCAP1 NM_002823.4  
AAATGTGGCCCCACTGGCCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTC
HKR341771 RBb54H03 pGCAP1 NM_002823.4  
AAATGTGGCCCCACATGGCCTGCTCTGGAAAAGCCATCGTTTGCATTGTTTCCTCATCCG
HKR342923 RBb57F03 pGCAP1 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR343279 RBb58D07 pGCAP1 NM_002823.4  
AAATGTGGCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTC
HKR343280 RBb58D08 pGCAP1 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR343777 RBb59H09 pGCAP1 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR344012 RBb60A12 pGCAP1 NM_002823.4  
HKR344057 RBb60C09 pGCAP1 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR344521 RBb61F01 pGCAP1 NM_002823.4  
GCCCCGCTGGACTGCGCTGAGACCCATCTTTGCATTGTTCCACCTCCGCCTCCTTGCTCG
HKR345225 RBb63B01 pGCAP1 NM_002823.4  
GGCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCT
HKR345274 RBb63D02 pGCAP1 NM_002823.4  
TGCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR345299 RBb63E03 pGCAP1 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR346033 RBb65B09 pGCAP1 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR346108 RBb65E12 pGCAP1 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR346853 RBb67C05 pGCAP1 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR347302 RBb68E06 pGCAP1 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR347324 RBb68F04 pGCAP1 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR348575 RBb71H07 pGCAP1 NM_002823.4  
TGGTGGACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR348979 RBb72H11 pGCAP1 NM_002823.4  
ATTGCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCT
HKR360531 RBd01F11 pGCAP10 NM_002823.4  
GCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCC
HKR361698 RBd04E02 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR362026 RBd05B02 pGCAP10 NM_002823.4  
CCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCG
HKR362549 RBd06G05 pGCAP10 NM_002823.4  
TGCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR364505 RBd11E09 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR365232 RBd13B08 pGCAP10 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR366009 RBd15A09 pGCAP10 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR366921 RBd17F01 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR368458 RBd21C10 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR368502 RBd21E06 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR368955 RBd22G11 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGANAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR369249 RBd23C01 pGCAP10 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR370577 RBd26H09 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR371280 RBd28D08 pGCAP10 NM_002823.4  
TTGACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCC
HKR371636 RBd29B12 pGCAP10 NM_002823.4  
GGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCCTCC
HKR372434 RBd31B10 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR372458 RBd31C10 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR373631 RBd34B07 pGCAP10 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR374058 RBd35C10 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR374435 RBd36B11 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR375302 RBd38E06 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR376481 RBd41D09 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR377727 RBd44F07 pGCAP10 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR378881 RBd47D09 pGCAP10 NM_002823.4  
GATTGTTCCTCATCCGCCTCCTTGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCCTCCGC
HKR380106 RBd50E10 pGCAP10 NM_002823.4  
GGCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR380172 RBd50H04 pGCAP10 NM_002823.4  
GCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGC
HKR380408 RBd51A08 pGCAP10 NM_002823.4  
GCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCC
HKR380876 RBd52D04 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR381355 RBd53G11 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR382128 RBd55F08 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCNNNNNCTTGCTCGCCGC
HKR382473 RBd56D01 pGCAP10 NM_002823.4  
TGTGATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGCNNCCGCCTCCGCCGCGC
HKR383656 RBd59C08 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR383731 RBd59F11 pGCAP10 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR384810 RBd62A10 pGCAP10 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR385308 RBd63E12 pGCAP10 NM_002823.4  
GCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCC
HKR385745 RBd64G01 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR385754 RBd64G10 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR386473 RBd66D01 pGCAP10 NM_002823.4  
TGACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCG
HKR387351 RBd68G07 pGCAP10 NM_002823.4  
TGCCCCNNNGGCTGCTCTGAGAAGCCANNNTTGCNTTGTTCNNNATCCGCCTCCTTGCTC
HKR387677 RBd69D05 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR388059 RBd70C11 pGCAP10 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR388156 RBd70G12 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR388173 RBd70H05 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR388922 RBd72F02 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR390906 RBd77E10 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR390931 RBd77F11 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR391259 RBd78C11 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR391746 RBd79G02 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR392931 RBd82F11 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR393656 RBd84C08 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR394173 RBd85H05 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR395260 RBd88C12 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR395278 RBd88D06 pGCAP10 NM_002823.4  
GCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGC
HKR395299 RBd88E03 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR395322 RBd88F02 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR396449 RBd91C01 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR398460 RBd96C12 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR398874 RBd97D02 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR399226 RBd98B02 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR399232 RBd98B08 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR399299 RBd98E03 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR403145 RBdS007O09 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR403179 RBdS007P19 pGCAP10 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR405319 RBdS013E23 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR405324 RBdS013F04 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR405406 RBdS013I14 pGCAP10 NM_002823.4  
GCCCCCANTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR405510 RBdS013M22 pGCAP10 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR405777 RBdS014H09 pGCAP10 NM_002823.4  
TGCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCT
HKR405786 RBdS014H18 pGCAP10 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR406040 RBdS015B16 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR416067 RBdS040C19 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR416102 RBdS040E06 pGCAP10 NM_002823.4  
TGACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCG
HKR416202 RBdS040I10 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR416379 RBdS040P19 pGCAP10 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR420434 RBdS051B10 pGCAP10 NM_002823.4  
TGCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR420570 RBdS051H02 pGCAP10 NM_002823.4  
TTGCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGC
HKR420752 RBdS051O16 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR428284 RBdS070L20 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR430031 RBdS075B07 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR430275 RBdS075L11 pGCAP10 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR432773 RBdS081P13 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR433290 RBdS083D18 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR441626 RBdS104B02 pGCAP10 NM_002823.4  
GGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCCTCC
HKR441722 RBdS104F02 pGCAP10 NM_002823.4  
GCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCC
HKR441758 RBdS104G14 pGCAP10 NM_002823.4  
GACTGNCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR441769 RBdS104H01 pGCAP10 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR441835 RBdS104J19 pGCAP10 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR441869 RBdS104L05 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR442228 RBdS105J12 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR442238 RBdS105J22 pGCAP10 NM_002823.4  
TGCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGC
HKR442354 RBdS105O18 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR444220 RBdS110J04 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR444288 RBdS110L24 pGCAP10 NM_002823.4  
GCCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTC
HKR444309 RBdS110M21 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR452837 RBdS132B13 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR461711 RBdS154E15 pGCAP10 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR461832 RBdS154J16 pGCAP10 NM_002823.4  
TCGACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCC
HKR461891 RBdS154M03 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR470971 RBdS177H03 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC
HKR470976 RBdS177H08 pGCAP10 NM_002823.4  
HKR474938 RBdS187F18 pGCAP10 NM_002823.4  
GCCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR474996 RBdS187I04 pGCAP10 NM_002823.4  
TGCCCACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCG
HKR475120 RBdS187N08 pGCAP10 NM_002823.4  
GACTGGCTGCTCTGAAAAGCCATCTTTGCATTGTTCCTCATCCGCCTCCTTGCTCGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl