Prev. |  KEGG KO K08870 > 

RIKEN DNA Bank Human Resource - TWF1

Gene ID NCBI Gene 5756 |  KEGG hsa:5756
Gene Symbol TWF1
Protein Name twinfilin actin binding protein 1
Synonyms A6|PTK9
Ortholog resource in our bank

  TWF1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067554 IRAK168O18 pBluescriptR BC068548 NM_198974 Full
HGY030726 IRAK076N14 pBluescriptR BC043148 NM_198974 Full
HGY094080 IRAL035D08 pDNR-LIB BC022344 NM_198974 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE046732 W01A116N20 pENTR-TOPO IRAK076N14 BC043148 NM_198974  
HGE046736 W01A116N24 pENTR-TOPO IRAK076N14 BC043148 NM_198974  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR164077 ARi10D05 pGCAP10 NM_002822.3  
GGGCTGCACTCAGCGCCGGAGCCGGGAGCTAGCGGCCGCCGCCATGTCCCACCAGACCGG
HKR203509 ARiS008M21 pGCAP10 NM_002822.3  
GGTcaGAGAGCANacgtcGGAgcAcTGAGCAGtcTAGATTCTGCGGCATGTCCCCCCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl