Prev. |  KEGG KO K05127 > 

RIKEN DNA Bank Human Resource - PTK7

Gene ID NCBI Gene 5754 |  KEGG hsa:5754
Gene Symbol PTK7
Protein Name protein tyrosine kinase 7 (inactive)
Synonyms CCK-4|CCK4
Ortholog resources KEGG ortholog (KEGG orthology K05127) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067576 IRAK168P16 pBluescriptR BC071557 NM_152882 Full/var
HGY080673 IRAL001L09 pOTB7 BC002377 NM_152882 Full/var
HGY084211 IRAL010I19 pOTB7 BC014626 NM_152882 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR177608 ARi44A08 pGCAP10 NM_002821.3  
GGCTTGGCGGCGGCGGCGGCGGCGCGCGGGGACTCGGAGGTACTGGGCGCGCGCGGCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl