Prev. |  KEGG KO K01079 > 

RIKEN DNA Bank Human Resource - PSPH

Gene ID NCBI Gene 5723 |  KEGG hsa:5723
Gene Symbol PSPH
Protein Name phosphoserine phosphatase
Synonyms PSP|PSPHD
Ortholog resources KEGG ortholog (KEGG orthology K01079) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY036120 IRAK090E24 pBluescript BC052958 NM_004577 Partial/var
HGX053629 IRAK134B05 pCMV-SPORT6 BC063614 NM_004577 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR385722 RBd64F02 pGCAP10 NM_004577.3  
GAGATCTGGTGTCTCCAGTTTACAGAAGCACTTGCAGAACTCATCAGAAGCCACCCCGCT
HKR471139 RBdS177O03 pGCAP10 NM_004577.3  
GAGATCTGGTGTCTCCAGTTTACAGAAGCACTTGCAGAACTCATCAGAAGCCACCCCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl