Prev. |  KEGG KO K06696 > 

RIKEN DNA Bank Human Resource - PSME1

Gene ID NCBI Gene 5720 |  KEGG hsa:5720
Gene Symbol PSME1
Protein Name proteasome activator subunit 1
Synonyms HEL-S-129m|IFI5111|PA28A|PA28alpha|REGalpha
Ortholog resources KEGG ortholog (KEGG orthology K06696) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080707 IRAL001M19 pOTB7 BC000352 NM_006263 Full
HGY084363 IRAL010P03 pOTB7 BC007503 NM_006263 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049349 ARe23G05 pKA1U5 NM_006263.2  
GACCGCTTTCGCTTTCCCTTCGCGGTGCCCACTCCNCTTCCTTGTGCGGCGCTAGGCCCC
HKR054900 ARe37E04 pKA1U5 NM_006263.2  
GGGAGCTGGGTGCGAGCGCCCTACCGCTTTCGCTTTCCCTTCGCGGTGCCCACATCCACT
HKR175608 ARi39A08 pGCAP10 NM_006263.2  
GACCGCTTTCGCTTTCCCTTCGCGGTGCCCACTCCACTCCTTGTGCGGCGCTAGGCCCCC
HKR179751 ARi49G07 pGCAP10 NM_006263.2  
GACTCCTTGTGCGGCGCTAGGCCCCCCGTCCCGGTCATGGCCATGCTCAGGGTCCAGCCC
HKR218010 ARiS045A10 pGCAP10 NM_006263.2  
TGGACTACCCAGGAAGGCGGAGCTGGGTGCGAGCGCCCTACCGCTTTCGCTTTCCCTTCG
HKR279336 ARiS198F16 pGCAP10 NM_006263.2  
GGTGCCCACTCCACTCCTTGTGCGGCGCTAGGCCCCCCGTCCCGGTCATGGCCATGCTCA
HKR402941 RBdS007F21 pGCAP10 NM_006263.2  
GACCGCTTTCGCTTTCCCTTCGCGGTGCCCACTCCACTCCTTGTGCGGCGCTAGGCCCCC
HKR444018 RBdS110A18 pGCAP10 NM_006263.2  
GCCTTGTGCGGCGCTAGGCCCCCCGTCCCGGTCATGGCCATGCTCAGGGTCCAGCCCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl