Prev. |  KEGG KO K03035 > 

RIKEN DNA Bank Human Resource - PSMD12

Gene ID NCBI Gene 5718 |  KEGG hsa:5718
Gene Symbol PSMD12
Protein Name proteasome 26S subunit, non-ATPase 12
Synonyms Rpn5|STISS|p55
Ortholog resource in our bank

  PSMD12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056725 IRAK141N13 pCMV-SPORT6.1 BC065826 NM_002816 Full/var
HGY095650 IRAL039C02 pOTB7 BC019062 NM_002816 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE022225 W01A055J09 pENTR-TOPO flj0015g13 AK091198 NM_174871.4 full done
HGE022227 W01A055J11 pENTR-TOPO flj0015g13 AK091198 NM_174871  
HGE022231 W01A055J15 pENTR-TOPO flj0015g13 AK091198 NM_174871  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR163377 ARi08H09 pGCAP10 NM_002816.3  
GAAGGGACGCTCAGGCGGGGACCATGGCGGACGGCGGCTCGGAGCGGGCTGACGGGCGCA
HKR249051 ARiS122K11 pGCAP10 NM_002816.3  
GAAGGGACCCTCANGCGNNNNCCATGGCGGACGGCGGCTCGGANCGGGCTGACGGGCGCA
HKR341698 RBb54E02 pGCAP1 NM_002816.3  
GGCCTGAGCGGGTGCGCGGGCAACTTCCGGTGTGGGTGACGAGTGGTGGCCGAAGCAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl