Prev. |  KEGG KO K03036 > 

RIKEN DNA Bank Human Resource - PSMD11

Gene ID NCBI Gene 5717 |  KEGG hsa:5717
Gene Symbol PSMD11
Protein Name proteasome 26S subunit, non-ATPase 11
Synonyms Rpn6|S9|p44.5
Ortholog resources KEGG ortholog (KEGG orthology K03036) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080475 IRAL001D03 pOTB7 BC000437 NM_002815 Full
HGY083667 IRAL009C19 pOTB7 BC004430 NM_002815 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068523 ARe71F03 pKA1U5 NM_002815.2  
NTACACGNGCNACTAGNGGNCAAAGGGGAAGAAGAAGGCATACCACNGCNTGTTACGTGC
HKR068571 ARe71H03 pKA1U5 NM_002815.2  
TGGCGGCCGGGGACGGTGTGAGAGCGGTAAGATGGCGGCGGCGGCGGTGGTGGAGTTCCA
HKR334122 RBb35F02 pGCAP1 NM_002815.2  
GAAGATGGCGGCGGCGGCGGTGGTGGAGTTCCAGAGAGCCCAGTCTCTACTCAGCACCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl