Prev. |  KEGG KO K03038 > 

RIKEN DNA Bank Human Resource - PSMD7

Gene ID NCBI Gene 5713 |  KEGG hsa:5713
Gene Symbol PSMD7
Protein Name proteasome 26S subunit, non-ATPase 7
Synonyms MOV34|P40|Rpn8|S12
Ortholog resources KEGG ortholog (KEGG orthology K03038) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080615 IRAL001I23 pOTB7 BC000338 NM_002811 Full/var
HGY087967 IRAL019P07 pDNR-LIB BC012606 NM_002811 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE021664 W01A054C16 pENTR-TOPO IRAL019P07 BC012606 NM_002811  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041256 ARe03C08 pKA1U5 NM_002811.3  
GAGAAGAGGAACTGGGCCTGAAAGGGTACCGGTGACCGCATACTGCTGCCGGTGTTTGCG
HKR058954 ARe47G10 pKA1U5 NM_002811.3  
TGAGAAGAGGAACTGGGCCTGAAAGGGTACCGGCTGTACCGCTACTGCTGCCGGTGTTTG
HKR182527 ARi56F07 pGCAP10 NM_002811.3  
GGAAGGAGGCCGCGCGAGGGCTGACGAACCGGAAGAAGAGGAACTGGGCCTGAAAGGGTA
HKR186980 ARi67H12 pGCAP10 NM_002811.3  
GGCCTGAAAGGGTACCGGTGACCGCTACTGCTGCCGGTGTTTGCGTGTGGCAGGGAGCCA
HKR364874 RBd12D02 pGCAP10 NM_002811.3  
GGAAGAGGAACTGGGCCTGAAAGGGTACCGGTGACCGCTACTGCTGCCGGTGTTTGCGTG
HKR405826 RBdS014J10 pGCAP10 NM_002811.3  
GAGGGCTGACGAACCGGAAGAAGAGGAACTGGGCCTGAAAGGGTACCGGTGACCGCTACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl