Prev. |  KEGG KO K03029 > 

RIKEN DNA Bank Human Resource - PSMD4

Gene ID NCBI Gene 5710 |  KEGG hsa:5710
Gene Symbol PSMD4
Protein Name proteasome 26S subunit, non-ATPase 4
Synonyms AF|AF-1|ASF|MCB1|Rpn10|S5A|pUB-R5
Ortholog resources KEGG ortholog (KEGG orthology K03029) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080489 IRAL001D17 pOTB7 BC002365 NM_002810 Full
HGY103454 IRAL058K14 pOTB7 BC072008 NM_002810 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006332 W01A015N20 pENTR-TOPO IRAL001D17 BC002365 NM_002810  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR055779 ARe39H11 pKA1U5 NM_002810.2  
GCCGGTCGGGAGGGAGGAAGGTGGCAAGATGGTGTTGGAAAGCACTATGGTGTGTGTGGA
HKR064449 ARe61C01 pKA1U5 NM_002810.2  
GGGAGACCCGGCTCGGGAGGGAGGAAGGTGGCANCATNGTGTTGGAAAGCACTATGGTGT
HKR179627 ARi49B03 pGCAP10 NM_002810.2  
GCCGGTCGGGAGGGAGGAAGGTGGCAAGATGGTGTTGGAAAGCACTATGGTGTGTGTGGA
HKR321745 RBb04G01 pKA1U5 NM_002810.2  
GCCGGTCGGGAGGGAGGAAGGTGGCAAGATGGTGTTGGAAAGCACTATGGTGTGCTGGCT
HKR321746 RBb04G02 pKA1U5 NM_002810.2  
GAGCGCGTTCGTGCGTCCTAGTTCCAGTACAGCGCTGGTAGGGTTTAGGCAGCGTGTTCT
HKR345774 RBb64H06 pGCAP1 NM_002810.2  
GGACCCGGTCGGGAGGGAGGAAGGTGGCAAGATGGTGTTGGAAAGCACTATGGTGTGTGT
HKR394034 RBd85B10 pGCAP10 NM_002810.2  
GGGTCGGGAGGGAGGAAGGTGGCAAGATGGTGTTGGAAAGCACTATGGTGTGTGTGGACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl