Prev. |  KEGG KO K03028 > 

RIKEN DNA Bank Human Resource - PSMD2

Gene ID NCBI Gene 5708 |  KEGG hsa:5708
Gene Symbol PSMD2
Protein Name proteasome 26S subunit, non-ATPase 2
Synonyms P97|RPN1|S2|TRAP2
Ortholog resources KEGG ortholog (KEGG orthology K03028) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080579 IRAL001H11 pOTB7 BC002368 NM_002808 Full
HGY083814 IRAL009I22 pOTB7 BC002997 NM_002808 Full
HGY088177 IRAL020H09 pOTB7 BC007897 NM_002808 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE084817 M01C012A17 pDONR221 FLJ03-E09 AK095245 NM_002808  
HGE084865 M01C012C17 pDONR221 FLJ03-E09 AK095245 NM_002808  
HGE084913 M01C012E17 pDONR221 FLJ03-E09 AK095245 NM_002808  
HGE084961 M01C012G17 pDONR221 FLJ03-E09 AK095245 NM_002808  
HGE085009 M01C012I17 pDONR221 FLJ03-E09 AK095245 NM_002808  
HGE085057 M01C012K17 pDONR221 FLJ03-E09 AK095245 NM_002808  
HGE085105 M01C012M17 pDONR221 FLJ03-E09 AK095245 NM_002808  
HGE085153 M01C012O17 pDONR221 FLJ03-E09 AK095245 NM_002808  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047325 ARe18F05 pKA1U5 NM_002808.3  
GGGCAGTGGCGGCGGAGATGGAGGAGGGAGGCCGGTACAAGGCGCCGGTGCAGCCCCAGC
HKR056478 ARe41D06 pKA1U5 NM_002808.3  
GGCGCGCGCCAGCGGGCCGGCAGNTGGTCGGTCGGTANCATGNAGGAGGGAATNCCTGGA
HKR060401 ARe51A01 pKA1U5 NM_002808.3  
GAGTGGCGGCGGAGATGGAGGAGGGAGGCCGGGACAAGGCGCCGGTGCAGCCCCAGCAGT
HKR068130 ARe70F10 pKA1U5 NM_002808.3  
TGGGTGCGCGCGCAGCGGGCCGGCAGTGGCGGCGGAGATGGAGGAGGGAGGCCGGGACAA
HKR205458 ARiS013K18 pGCAP10 NM_002808.3  
GGGCAGTGGCGGCGGAGATGGAGGAGGGAGGCCGGGACAAGGCGCCGGTGCAGCCCCAGC
HKR209512 ARiS023M24 pGCAP10 NM_002808.3  
GGGCAGTGGCGGCGGANATGGAGGAGGGAGGCCGGGACAAGGCGCCGGTGCAGCCCCAGC
HKR235101 ARiS087M13 pGCAP10 NM_002808.3  
GAGTGGCNGCNNANATGGAGGAGGGAGGCCGGGACAAGGCGCCGGTGCAGCCCCAGCAGT
HKR249096 ARiS122M08 pGCAP10 NM_002808.3  
GAGCGGGCCGGCAGTGGCGGCGGAGATGGAGGAGGGAGGCCGGGACAAGGCGCCGGTGCA
HKR324899 RBb12E03 pKA1U5 NM_002808.3  
GGGCAGTGGCGGCGGAGATGGAGGAGGGAGGCCGGGTACAAGGCGCCGGTTGCAGCCCCA
HKR332036 RBb30B12 pGCAP1 NM_002808.3  
GAGTGGCGGCGGAGATGGAGGAGGGAGGCCGGGACAAGGCGCCGGTGCAGCCCCAGCAGT
HKR381699 RBd54E03 pGCAP10 NM_002808.3  
GAGGGCGGTGCGAGCGGGTGCGCGCGCAGCGGGCCGGCAGTGGNGNCGGAGATGGAGGAG
HKR396123 RBd90F03 pGCAP10 NM_002808.3  
GAGGGCGGTGCGAGCGGGTGCGCGCGCAGCGGGCCGGCAGTGGCGGCGGAGATGGAGGAG
HKR442147 RBdS105G03 pGCAP10 NM_002808.3  
GGCGCGCGCAGCGGGCCGGCAGTGGCGGCGGAGATGGAGGAGGGAGGCCGGGACAAGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl