Prev. |  KEGG KO K03066 > 

RIKEN DNA Bank Human Resource - PSMC5

Gene ID NCBI Gene 5705 |  KEGG hsa:5705
Gene Symbol PSMC5
Protein Name proteasome 26S subunit, ATPase 5
Synonyms S8|SUG-1|SUG1|TBP10|TRIP1|p45|p45/SUG
Ortholog resources KEGG ortholog (KEGG orthology K03066) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080531 IRAL001F11 pOTB7 BC002367 NM_002805 Full
HGY083807 IRAL009I15 pOTB7 BC001932 NM_002805 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE001940 W01A004O04 pENTR-TOPO IRAL009I15 BC001932 NM_002805  
HGE001942 W01A004O06 pENTR-TOPO IRAL009I15 BC001932 NM_002805  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR058924 ARe47F04 pKA1U5 NM_002805.4  
GGCTTCCGCGCTTGCGCGCCAAGACGGCTCGGATGCCGGCGGTCTCTGCTGAAGAGAGAA
HKR082410 ARf06A10 pKA1U5 NM_002805.4  
GAGAGAAGATGGCGCTTGACGGACCAGAGCAGATGGAGCTGGAGGAGGGGAAGGCAGGCA
HKR344551 RBb61G07 pGCAP1 NM_002805.4  
GGTGAGTGAGGGAAGCGATGGGCGCGGGAATGGCCGGCCCACGGGTCGCAGGAGACGGGA
HKR346174 RBb65H06 pGCAP1 NM_002805.4  
TTGGCGCGCCAAGACGGCTCGGATGCCGGCGGTCTCTGCTGAAGAGAGAAGATGGCGCTT
HKR372829 RBd32B05 pGCAP10 NM_002805.4  
GTCGGATGCCGGCGGTCTCTGCTGAAGAGAGAAGATGGCGCTTGACGGACCAGAGCAGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl