Prev. |  KEGG KO K03063 > 

RIKEN DNA Bank Human Resource - PSMC4

Gene ID NCBI Gene 5704 |  KEGG hsa:5704
Gene Symbol PSMC4
Protein Name proteasome 26S subunit, ATPase 4
Synonyms MIP224|RPT3|S6|TBP-7|TBP7
Ortholog resources KEGG ortholog (KEGG orthology K03063) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080649 IRAL001K09 pOTB7 BC000343 NM_006503 Full
HGY087629 IRAL019B05 pDNR-LIB BC010396 NM_153001 Full
HGY093924 IRAL034N12 pOTB7 BC014488 NM_006503 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006718 W01A016N06 pENTR-TOPO IRAL001K09 BC000343 NM_006503  
HGE006720 W01A016N08 pENTR-TOPO IRAL001K09 BC000343 NM_006503  
HGE037812 W01A094I20 pENTR-TOPO IRAL034N12 BC014488 NM_006503  
HGE037816 W01A094I24 pENTR-TOPO IRAL034N12 BC014488 NM_006503  
HGE037844 W01A094K04 pENTR-TOPO IRAL034N12 BC014488 NM_006503  
HGE037862 W01A094K22 pENTR-TOPO IRAL034N12 BC014488 NM_006503  
HGE046911 W01A117E15 pENTR-TOPO IRAL034N12 BC014488 NM_006503  
HGE046919 W01A117E23 pENTR-TOPO IRAL034N12 BC014488 NM_006503  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR190153 ARi75G09 pGCAP10 NM_006503.2  
CGGCCGGCCGATGGGTCACTATGGAGGAGATAGGCATCTTGGTGGAGAAGGCTCAGGATG
HKR370883 RBd27D11 pGCAP10 NM_006503.2  
GATCATCCCAGGCCACACAGAGGCCGGCTTGGTCACTATGGAGGAGATAGGCATCTTGGT
HKR444247 RBdS110K07 pGCAP10 NM_006503.2  
TGGGACACAGAGGCCGGCTTGGTCACTATGGAGGAGATAGGCATCTTGGTGGAGAAGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl