Prev. |  KEGG KO K02738 > 

RIKEN DNA Bank Human Resource - PSMB6

Gene ID NCBI Gene 5694 |  KEGG hsa:5694
Gene Symbol PSMB6
Protein Name proteasome subunit beta 6
Synonyms DELTA|LMPY|Y
Ortholog resources KEGG ortholog (KEGG orthology K02738) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001975 IRAK004P15 pCMV-SPORT6 BC000835 NM_002798 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE005006 W01A012I14 pENTR-TOPO IRAK004P15 BC000835 NM_002798  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043274 ARe08D02 pKA1U5 NM_002798.1  
GACCGGAGGAGAAAGATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCACCG
HKR044169 ARe10H01 pKA1U5 NM_002798.1  
GGGAGGAGAAAGATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCACCGGCT
HKR046153 ARe15G09 pKA1U5 NM_002798.1  
GGGAGGAGAAAGATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCACCGGCT
HKR069332 ARe73F12 pKA1U5 NM_002798.1  
GGAGGAGAAAGATGGCGGCTACCTTACTAGCTGCTCNGGGAGCCGGGCCAGCACCGGCTT
HKR170145 ARi25G01 pGCAP10 NM_002798.1  
GACCGGAGGAGAAAGATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCACCG
HKR186505 ARi66E09 pGCAP10 NM_002798.1  
GAGTACCGGAGGAGAAAGATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCA
HKR222134 ARiS055F14 pGCAP10 NM_002798.1  
GGAGGCAGTACCGGAGGAGAAAGATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGC
HKR234067 ARiS085C19 pGCAP10 NM_002798.1  
CGGGGAGGAGAAAGATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCACCGG
HKR247581 ARiS118P21 pGCAP10 NM_002798.1  
TGAGGAGAAAGATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCACCGGCTT
HKR260021 ARiS150A21 pGCAP10 NM_002798.1  
GGGAGAAAGATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCACCGGCTTGG
HKR279251 ARiS198C03 pGCAP10 NM_002798.1  
GGGNGGNGNAGAAGGCGGCAACCNNACNAGCNGNNCGGGGAGCCGGGCCGGCNCCGGCNN
HKR323300 RBb08E04 pKA1U5 NM_002798.1  
GGAGGAGAAAGATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCACCGGCTT
HKR323608 RBb09A08 pKA1U5 NM_002798.1  
GGAGGAGAAAGATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCACCGGCTT
HKR324027 RBb10B03 pKA1U5 NM_002798.1  
GAGGAGAAAGATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCACCGGCTTG
HKR325279 RBb13D07 pKA1U5 NM_002798.1  
GGCGCTTTACGACAGTTGCTTTGAGGCAGTACCGGAGGAGAAAGATGGCGGCTACCTTAC
HKR332923 RBb32F03 pGCAP1 NM_002798.1  
TGGACCGGAGGAGAAAGATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCAC
HKR397682 RBd94D10 pGCAP10 NM_002798.1  
GGGAGGAGAAAGATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCACCGGCT
HKR409092 RBdS022M04 pGCAP10 NM_002798.1  
GGCTTTGAGGCAGTACCGGAGGAGAAAGATGGCGGCTACCTTACTAGCTGCTCGGGGAGC
HKR471118 RBdS177N06 pGCAP10 NM_002798.1  
GACCGGAGGAGAAAGATGGCGGCTACCTTACTAGCTGCTCGGGGAGCCGGGCCAGCACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl