Prev. |  KEGG KO K02736 > 

RIKEN DNA Bank Human Resource - PSMB4

Gene ID NCBI Gene 5692 |  KEGG hsa:5692
Gene Symbol PSMB4
Protein Name proteasome 20S subunit beta 4
Synonyms HN3|HsN3|PRAAS3|PROS-26|PROS26
Ortholog resource in our bank

  PSMB4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080601 IRAL001I09 pOTB7 BC000331 NM_002796 Full/var
HGY088999 IRAL022I07 pOTB7 BC008314 NM_002796 Full
HGY089423 IRAL023J07 pOTB7 BC017486 NM_002796 Full/var
HGY089466 IRAL023L02 pOTB7 BC017451 NM_002796 Full/var
HGY090816 IRAL027A16 pOTB7 BC010088 NM_002796 Full/var
HGY090864 IRAL027C16 pOTB7 BC010098 NM_002796 Full
HGY090942 IRAL027F22 pOTB7 BC011768 NM_002796 Full/var
HGY091864 IRAL029K24 pOTB7 BC012168 NM_002796 Full/var
HGY095950 IRAL039O14 pOTB7 BC017307 NM_002796 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE005305 W01A013E09 pENTR-TOPO IRAL023L02 BC017451 NM_002796  
HGE005317 W01A013E21 pENTR-TOPO IRAL001I09 BC000331 NM_002796  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234954 ARiS087G10 pGCAP10 NM_002796.2  
GATTTTTTCTGCTACCGTGACTAAGATGGAAGCGTTTTTGGGGTCGCGGTCCGGACTTTG
HKR368971 RBd22H03 pGCAP10 NM_002796.2  
GATTTTTTCTGCTACCGTGACTAAGATGGAAGCGTTTTTGGGGTCGCGGTCCGGACTTTG
HKR370946 RBd27G02 pGCAP10 NM_002796.2  
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTGCTACCGGGACTAAAATG
HKR377606 RBd44A06 pGCAP10 NM_002796.2  
GCATTTTTTCTGCTACCGTGACTAAGATGGAAGCGTTTTTGGGGTCGCGGTCCGGACTTT
HKR453180 RBdS132P20 pGCAP10 NM_002796.2  
TATTTTTTCTGCTACCGTGACTAAGATGGAAGCGTTTTTGGGGTCGCGGTCCGGACTTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl