Prev. |  KEGG KO K02735 > 

RIKEN DNA Bank Human Resource - PSMB3

Gene ID NCBI Gene 5691 |  KEGG hsa:5691
Gene Symbol PSMB3
Protein Name proteasome subunit beta 3
Synonyms HC10-II
Ortholog resources KEGG ortholog (KEGG orthology K02735) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084066 IRAL010C18 pOTB7 BC013008 NM_002795 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE004748 W01A011O12 pENTR-TOPO IRAL010C18 BC013008 NM_002795  
HGE004750 W01A011O14 pENTR-TOPO IRAL010C18 BC013008 NM_002795  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048054 ARe20C06 pKA1U5 NM_002795.2  
GAGTGAGAGCGGTTGCGCAGTGAAGGCTAGACCCGGTTTACTGGAATTGCTCTGGCGATC
HKR066545 ARe66G01 pKA1U5 NM_002795.2  
GGGAATTGCTCTGGCGATCGAGGGGTCCTAGCTACACCGCAATCATGTCTATTATGTCCT
HKR067701 ARe69E05 pKA1U5 NM_002795.2  
GGGTTGCGCAGTGAAGGCTAGACCCGGTTTACTGGAATTGCTCTGGCGATCGAGGGGTCC
HKR238567 ARiS096G23 pGCAP10 NM_002795.2  
GGCAGTGAAGGCTAGACCCGGTTTACTGGAATTGCTCTGGCGATCGAGGGGTCCTAGTAC
HKR366949 RBd17G05 pGCAP10 NM_002795.2  
GCTAGTACACCGCAATCATGTCTATTATGTCCTATAACGGAGGGGCCGTCATGGCCATGA
HKR367725 RBd19F05 pGCAP10 NM_002795.2  
GACTGGAATTGCTCTGGCGATCGAGGGGTCCTAGTACACCGCAATCATGTCTATTATGTC
HKR381756 RBd54G12 pGCAP10 NM_002795.2  
GGCAGTGAAGGCTAGACCCGGTTTACTGGAATTGCTCTGGCGATCGAGGGGTCCTAGTAC
HKR382177 RBd55H09 pGCAP10 NM_002795.2  
GACTGGAATTGCTCTGGCGATCGAGGGGTCCTAGTACACCGCNNTNNNNTCTATTATGTC
HKR391346 RBd78G02 pGCAP10 NM_002795.2  
GCCGGTTTACTGGAATTGCTCTGGCGATCGAGGGGTCCTAGTACACCGCAATCATGTCTA
HKR402822 RBdS007A22 pGCAP10 NM_002795.2  
TGAGTGAAGGCTAGACCCGGTTTACTGGAATTGCTCTGGCGATCGAGGGGTCCTAGTACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl