Prev. |  KEGG KO K02729 > 

RIKEN DNA Bank Human Resource - PSMA5

Gene ID NCBI Gene 5686 |  KEGG hsa:5686
Gene Symbol PSMA5
Protein Name proteasome 20S subunit alpha 5
Synonyms PSC5|ZETA
Ortholog resources KEGG ortholog (KEGG orthology K02729) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051351 ARe28G07 pKA1U5 NM_002790.2  
TTGAGTACTGCGGCCGTGTGGGTGAGTTGGCTGCCGGTGAGTTGGGTGCCGGTGGAGTCG
HKR184056 ARi60C08 pGCAP10 NM_002790.2  
GGTCCTTAGTACTGCGGCCGTGTGGGTGAGTTGGCTGCCGGTGAGTTGGGTGCCGGTGGA
HKR234817 ARiS087A17 pGCAP10 NM_002790.2  
GCGNNGGNCCNNNGNNCNGCGGCCGAGAGGGNGAGNNGGCNGCCGGNGAGTTNNNGNGCC
HKR247295 ARiS118D23 pGCAP10 NM_002790.2  
GAGTACTGCGGCCGTGTGGGTGAGTTGGCTGCCGGTGAGTTGGGTGCCGGTGGAGTCGTG
HKR341651 RBb54C03 pGCAP1 NM_002790.2  
GGCGGCCGTGTGGGTGAGTTGGCTGCCGGTGAGTTGGGTGCCGGTGGAGTCGTGTTGGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl