Prev. |  KEGG KO K02725 > 

RIKEN DNA Bank Human Resource - PSMA1

Gene ID NCBI Gene 5682 |  KEGG hsa:5682
Gene Symbol PSMA1
Protein Name proteasome subunit alpha 1
Synonyms HC2|HEL-S-275|NU|PROS30
Ortholog resources KEGG ortholog (KEGG orthology K02725) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008022 IRAK020A22 pCMV-SPORT6 BC015356 NM_002786 Full
HGY081674 IRAL004D02 pOTB7 BC002577 NM_002786 Full
HGY088485 IRAL021D13 pDNR-LIB BC009576 NM_002786 Full
HGY088572 IRAL021H04 pDNR-LIB BC008472 NM_002786 Full
HGY088707 IRAL021M19 pDNR-LIB BC005932 NM_002786 Full/var
HGY092570 IRAL031H02 pDNR-LIB BC015105 NM_002786 Full
HGY095098 IRAL037M10 pDNR-LIB BC022372 NM_002786 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE014253 W01A035K13 pENTR-TOPO IRAL004D02 BC002577 NM_002786  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043325 ARe08F05 pKA1U5 NM_002786.3  
AGATCGCTGAGCGATACTTTCGGCAGCACCTCCTTGATTCTCAGTTTTGCTGGAGGCCGC
HKR049282 ARe23D10 pKA1U5 NM_002786.3  
GCTCCTTGATTCTCAGTTTTGCTGGAGGCCGCAACCAGGCCCGCGCCGCCACCATGTTTC
HKR054875 ARe37D03 pKA1U5 NM_002786.3  
GCTCTGTAGATCGCTGAGCGATACTTTCGGCAGCACCTCCTTGATTCTCAGTTTTGCTGG
HKR061726 ARe54F06 pKA1U5 NM_002786.3  
GGAGCGATACTTTCGGCAGCACCTCCTTGATTCTCAGTTTTGCTGGAGGCCGCAACCAGG
HKR162836 ARi07B12 pGCAP10 NM_002786.3  
GCTCCTTGATTCTCAGTTTTGCTGGAGGCCGCAACCAGGCCCGCGCCGCCACCATGTTTC
HKR177281 ARi43D09 pGCAP10 NM_002786.3  
CGGCCGGCCGATAGATCGCTGAGCGATACTTTCGGCAGCACCTCCTTGATTCTCAGTTTT
HKR182097 ARi55E01 pGCAP10 NM_002786.3  
GGGCAGCACCTCCTTGATTCTCAGTTTTGCTGGAGGCCGCAACCAGGCCCGCGCCGCCAC
HKR182508 ARi56E12 pGCAP10 NM_002786.3  
GACTTTCGGCAGCACCTCCTTGATTCTCAGTTTTGCTGGAGGCCGCAACCAGGCCCGCGC
HKR260157 ARiS150G13 pGCAP10 NM_002786.3  
GAGGCCGCAACCAGGCCCGCGCCGCCACCATGTTTCGAAATCAGTATGACAATGATGTCA
HKR334036 RBb35B12 pGCAP1 NM_002786.3  
TAGCACCTCCTTGATTCTCAGCTTTTGCTGGAGGCCGCAACCAGGCCCGCGCCGCCACCA
HKR379325 RBd48F05 pGCAP10 NM_002786.3  
GACCTCCTTGATTCTCAGTTTTGCTGGAGGCCGCAACCAGGCCCGCGCCGCCACCATGTT
HKR383771 RBd59H03 pGCAP10 NM_002786.3  
GAGCACCTCCTTGATTCTCAGTTTTGCTGGAGGCCGCAACCAGGCCCGCGCCGCCACCAT
HKR433582 RBdS083P22 pGCAP10 NM_002786.3  
GCTCAGTTTTGCTGGAGGCCGCAACCAGGCCCGCGCCGCCACCATGTTTCGAAATCAGTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl