Prev. |  KEGG KO K06500 > 

RIKEN DNA Bank Human Resource - PSG4

Gene ID NCBI Gene 5672 |  KEGG hsa:5672
Gene Symbol PSG4
Protein Name pregnancy specific beta-1-glycoprotein 4
Synonyms PSBG-4|PSBG-9|PSG9
Ortholog resources KEGG ortholog (KEGG orthology K06500) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088691 IRAL021M03 pDNR-LIB BC008405 NM_213633
HGY100619 IRAL051J03 pDNR-LIB BC063127 NM_002780 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR053378 ARe33H10 pKA1U5 NM_002780.3  
GACAGAAAGAGGAAGGACAGCACAGCTGACAGCCGTGCTCAGAGAGTTTCTGGATCCTAG
HKR058570 ARe46H02 pKA1U5 NM_002780.3  
GAGAAGGAGGAAGGACAGCACAGCTGACAGCCGCCNTTTANGAAGCTTCTGGATCCTAGG
HKR064405 ARe61A05 pKA1U5 NM_002780.3  
GACAGAAAGAGGAAGGACAGCACAGCTGACAGCCGCTGNTTCAGAGAGTTTCTGGATCCT
HKR186122 ARi65F02 pGCAP10 NM_002780.3  
GAGCACAGAAGGAGGAAGGACAGCACAGCTGACAGCCGTACTCAGGAAGCTTCTGGATCC
HKR222183 ARiS055H15 pGCAP10 NM_002780.3  
GACANAANGNNGAAGGACCCCACNNCTGACAGCCNNACTCAGGAAGCTTCTGGATCCTAN
HKR234107 ARiS085E11 pGCAP10 NM_002780.3  
GACAGAAGGAGGAAGGACAGCACAGCTGACAGCCGTACTCAGGAAGCTTCTGGATCCTAG
HKR235272 ARiS088C24 pGCAP10 NM_002780.3  
GACAGAAAGAGGAAGGACAGCACAGCTGACAGCCGTGCTCAGAGAGTTTCTGGATCCTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl