Prev. |  KEGG KO K08784 > 

RIKEN DNA Bank Human Resource - HTRA1

Gene ID NCBI Gene 5654 |  KEGG hsa:5654
Gene Symbol HTRA1
Protein Name HtrA serine peptidase 1
Synonyms ARMD7|CADASIL2|CARASIL|HtrA|L56|ORF480|PRSS11
Ortholog resource in our bank

  HTRA1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019419 IRAK048J03 pBluescriptR BC031082 NM_002775 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE090031 M01C025B07 pDONR221 MGC02-C04 BC031082 NM_002775  
HGE090079 M01C025D07 pDONR221 MGC02-C04 BC031082 NM_002775  
HGE090127 M01C025F07 pDONR221 MGC02-C04 BC031082 NM_002775  
HGE090175 M01C025H07 pDONR221 MGC02-C04 BC031082 NM_002775  
HGE090223 M01C025J07 pDONR221 MGC02-C04 BC031082 NM_002775  
HGE090271 M01C025L07 pDONR221 MGC02-C04 BC031082 NM_002775  
HGE090319 M01C025N07 pDONR221 MGC02-C04 BC031082 NM_002775  
HGE090367 M01C025P07 pDONR221 MGC02-C04 BC031082 NM_002775  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044122 ARe10F02 pKA1U5 NM_002775.3  
GACTCTCCCCGGCGCCGCTCTCCGGCCCTCGCCCTGTTCCGCCGCCACCGCCGCCGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl