Prev. |  KEGG KO K01369 > 

RIKEN DNA Bank Human Resource - LGMN

Gene ID NCBI Gene 5641 |  KEGG hsa:5641
Gene Symbol LGMN
Protein Name legumain
Synonyms AEP|LGMN1|PRSC1
Featured content Lysosome (human)
Ortholog resource in our bank

  LGMN

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008403 IRAK021A03 pCMV-SPORT6 BC013678 NM_005606 Partial
HGY083141 IRAL007O05 pOTB7 BC003061 NM_005606 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR075627 ARe89B03 pKA1U5 NM_001008530.1  
GACAGCAGTGCCGACGTCGTGGGTGTTTGGTGTGAGGCTGCGAGCCGCCGCGAGTTCTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl