Prev. | 

RIKEN DNA Bank Human Resource - PRPSAP2

Gene ID NCBI Gene 5636 |  KEGG hsa:5636
Gene Symbol PRPSAP2
Protein Name phosphoribosyl pyrophosphate synthetase associated protein 2
Synonyms PAP41
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172059 ARi30C11 pGCAP10 NM_002767.2 done
GGCCCCTCCCCGCCCACCGGCCTCGCAGTCACCGCGGACGCCAATCTTGTGCATGGAGTC
HKR444305 RBdS110M17 pGCAP10 NM_002767.2  
GGGAGTCGCCATTTTGCTCCTAGAGAGGCCGCCAGGAGACCCGGCGCTTTCTTCCTTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl