Prev. |  KEGG KO K00948 > 

RIKEN DNA Bank Human Resource - PRPS1

Gene ID NCBI Gene 5631 |  KEGG hsa:5631
Gene Symbol PRPS1
Protein Name phosphoribosyl pyrophosphate synthetase 1
Synonyms ARTS|CMTX5|DFN2|DFNX1|PPRibP|PRS-I|PRSI
Ortholog resources KEGG ortholog (KEGG orthology K00948) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083444 IRAL008K04 pOTB7 BC001605 NM_002764

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044873 ARe12D01 pKA1U5 NM_002764.3  
AAGATGGCGGAGTAGCAACGCAAAGCGCGTTGGCTNTTGAGTCTGTGGCCGACTTCGGTT
HKR181751 ARi54G07 pGCAP10 NM_002764.3  
GAATGTAAGATGGCGGAGTAGCAACGCAAAGCGCTTGGTATTGAGTCTGTGGCCGACTTC
HKR326171 RBb15H03 pKA1U5 NM_002764.3  
GAGAGCCGCGCGCCGGGCGGGAATGTAAGATGGCGGAGTAGCAACGCAAAGCGCTTGGTA
HKR360812 RBd02A12 pGCAP10 NM_002764.3  
GGTAAGATGGCGGAGTAGCAACGCAAAGCGCTTGGTATTGAGTCTGTGGCCGACTTCGGT
HKR416205 RBdS040I13 pGCAP10 NM_002764.3  
GAGAGCCGCGCGCCGGGCGGGAATGTAAGATGGCGGAGTAGCAACGCAAAGCGCTTGGTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl