Prev. | Human A to Z list > T > 

RIKEN DNA Bank Human Resource - THAP12

Gene ID (NCBI) 5612
Gene Symbol THAP12
Protein Name THAP domain containing 12
Synonyms DAP4|P52rIPK|PRKRIR|THAP0
Databases KEGG hsa:5612 |  NCBI Gene 5612
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR079323 ARe98F03 pKA1U5 NM_004705.2  
GGCATTGTGGGAAGGAGGCGGCAGCGTCTCGGGCGGGCGGGAGGTGCACCAGCGGCGGCG
HKR372859 RBd32C11 pGCAP10 NM_004705.2  
GCCCCCGCGCGTCGGCCCTGCCGAGCCGGCCGGCCGGCCTGGCTCCCCTCCCCGGCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl