Prev. |  KEGG KO K09523 > 

RIKEN DNA Bank Human Resource - DNAJC3

Gene ID NCBI Gene 5611 |  KEGG hsa:5611
Gene Symbol DNAJC3
Protein Name DnaJ heat shock protein family (Hsp40) member C3
Synonyms ACPHD|ERdj6|HP58|P58|P58IPK|PRKRI|p58(IPK)
Featured content Influenza A relevant genes - human
Ortholog resource in our bank

  DNAJC3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX035628 IRAK089B04 pCMV-SPORT6 BC047936 NM_006260 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR165208 ARi13A08 pGCAP10 NM_006260.3  
GGAGCGAGAGCCGACGGCGGGCGGGCGCAGCTGCTGCCGGAGCGCCGGCGCGTGCTGGTG
HKR178502 ARi46E06 pGCAP10 NM_006260.3  
GGCTGGGCTCCAGAGCCCCTGAGGCCTGAGCGAGAGCCGACGGCGGGCGGGCGCAGCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl