Prev. |  KEGG KO K16195 > 

RIKEN DNA Bank Human Resource - EIF2AK2

Gene ID NCBI Gene 5610 |  KEGG hsa:5610
Gene Symbol EIF2AK2
Protein Name eukaryotic translation initiation factor 2 alpha kinase 2
Synonyms EIF2AK1|PKR|PPP1R83|PRKR
Featured content SARS-CoV-2 relevant human genes
Featured content Influenza A relevant genes - human
Ortholog resource in our bank

  EIF2AK2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX035228 IRAK088B04 pCMV-SPORT6 BC040851 NM_002759 Partial/var
HGY053517 IRAK133N05 pBluescript BC057805 NM_002759 Partial/var
HGY087076 IRAL017L12 pOTB7 BC007769 NM_002759 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR047769 ARe19H01 pKA1U5 NM_002759.2  
GGGGTCTCCGGCCGGCGGCGGCGGCGGCGGCGGCGGCGGCGCAGGTTTGCTTCTCTGGCG
HKR398527 RBd96F07 pGCAP10 NM_002759.2  
GACTGGCTGGGAAGCGGTCGGTCGAGTGTGGCCTGTGTGGACTCGCATCTTGCCCGAAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl