Prev. |  KEGG KO K04431 > 

RIKEN DNA Bank Human Resource - MAP2K7

Gene ID NCBI Gene 5609 |  KEGG hsa:5609
Gene Symbol MAP2K7
Protein Name mitogen-activated protein kinase kinase 7
Synonyms JNKK2|MAPKK7|MEK|MEK 7|MKK7|PRKMK7|SAPKK-4|SAPKK4
Featured content MAP kinases (human)
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content T cell receptor signaling pathway (human)
Ortholog resource in our bank

  MAP2K7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019140 IRAK047O04 pBluescriptR BC038295 NM_145185 Full/var
HGY086567 IRAL016G23 pDNR-LIB BC005365 NM_145185 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR475114 RBdS187N02 pGCAP10 NM_145185.2  
GGTGCGGTGTTTGTCTGCCGGACTGACGGGCGGCCGGGCGGTGCGCGGCGGCGGTGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl