DNA Bank Top |  KEGG KO K04368 > 

RIKEN DNA Bank Human Resource - MAP2K1

Gene ID NCBI Gene 5604 |  KEGG hsa:5604
Gene Symbol MAP2K1
Protein Name mitogen-activated protein kinase kinase 1
Synonyms CFC3|MAPKK1|MEK1|MEL|MKK1|PRKMK1
Featured content MAP kinases (human)
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Sphingolipid signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content HIF-1 signaling pathway - human
Featured content Apoptosis - human
Featured content Influenza A relevant genes - human

Link

Ortholog resource in our bank

  MAP2K1

External database

human MAP2K1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB14154 pACYC184-Venus-MEK1 (S218/222E, delta32-51) Plasmid clone of constitutive active form of human MEK1.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR203222 ARiS008A22 pGCAP10 NM_002755.3  
GGCCGCTTCGCAGAGCGGCTAGGAGCACGGCGGCGGCGGCACTTTCCCCGGCAGGAGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.03

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl