RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - MAPK11

Gene ID	NCBI Gene 5600 \| KEGG hsa:5600
Gene Symbol	MAPK11
Protein Name	mitogen-activated protein kinase 11
Synonyms	P38B\|P38BETA2\|PRKM11\|SAPK2\|SAPK2B\|p38-2\|p38Beta
Featured content	MAP kinases (human)
Featured content	MAPK p38 inhibitor screening
Featured content	Signaling pathways regulating pluripotency of stem cells (human)
Featured content	Sphingolipid signaling pathway (human)
Featured content	T cell receptor signaling pathway (human)
Featured content	Amyotrophic lateral sclerosis (ALS) - human
Featured content	SARS-CoV-2 relevant human genes

Ortholog resource in our bank

  MAPK11

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number	Name of Resource	Description
RDB12359	pcDNA3Flag-hp38beta2	Expression vector of human p38beta MAPK cDNA, FLAG-tagged
RDB12360	pcDNA3Flag-hp38beta2T106M	Expression vector of human p38beta MAPK cDNA, inhibitor-insensitive T106M mutant, FLAG-tagged.

webcatalog20220516.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR462408	RBdS156A08	pGCAP10	NM_002751.7	Full/var
HKR462408	GGCTCGGCTCGGGCTCGGCTCGGGCGCGGGCGCGGGGCGCGGGGCTGGGCCCGGGCGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl