DNA Bank Top |  KEGG KO K04441 > 

RIKEN DNA Bank Human Resource - MAPK11

Gene ID NCBI Gene 5600 |  KEGG hsa:5600
Gene Symbol MAPK11
Protein Name mitogen-activated protein kinase 11
Synonyms P38B|P38BETA2|PRKM11|SAPK2|SAPK2B|p38-2|p38Beta
Featured content MAP kinases (human)
Featured content MAPK p38 inhibitor screening
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Sphingolipid signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content Amyotrophic lateral sclerosis (ALS) - human
Featured content SARS-CoV-2 relevant human genes

Link

Ortholog resource in our bank

  MAPK11


External database

human MAPK11

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB12360 pcDNA3Flag-hp38beta2T106M Expression vector of human p38beta MAPK cDNA, inhibitor-insensitive T106M mutant, FLAG-tagged.    
RDB12359 pcDNA3Flag-hp38beta2 Expression vector of human p38beta MAPK cDNA, FLAG-tagged    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR462408 RBdS156A08 pGCAP10 NM_002751.7 Full/var done
GGCTCGGCTCGGGCTCGGCTCGGGCGCGGGCGCGGGGCGCGGGGCTGGGCCCGGGCGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.01

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl