Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MAPK8

Gene ID (NCBI) 5599
Gene Symbol MAPK8
Protein Name mitogen-activated protein kinase 8
Synonyms JNK|JNK-46|JNK1|JNK1A2|JNK21B1/2|PRKM8|SAPK1|SAPK1c
Databases KEGG hsa:5599 |  NCBI Gene 5599
Featured content MAP kinases (human)
Featured content Wnt signaling pathway (human)
Featured content Sphingolipid signaling pathway (human)
Featured content Apoptosis - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K04440)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB06088 pEThsJNK1 Expression vector of human JNK1 coding sequence
RDB06089 pT7Cam_hsJNK1 Expression vector of human JNK1 coding sequence

RDB_org_170226.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR444011 RBdS110A11 pGCAP10 NM_002750.2  
GACGGCCCGCGTCTCTGTTACTCAGCCGAGCGGCCGAGGCCGGACGACGCGGCTTGGATT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl