DNA Bank Top |  KEGG KO K04440 > 

RIKEN DNA Bank Human Resource - MAPK8

Gene ID NCBI Gene 5599 |  KEGG hsa:5599
Gene Symbol MAPK8
Protein Name mitogen-activated protein kinase 8
Synonyms JNK|JNK-46|JNK1|JNK1A2|JNK21B1/2|PRKM8|SAPK1|SAPK1c
Featured content MAP kinases (human)
Featured content Wnt signaling pathway (human)
Featured content Sphingolipid signaling pathway (human)
Featured content Apoptosis - human
Featured content SARS-CoV-2 relevant human genes
Featured content Mitophagy - human

Link

Ortholog resource in our bank

  MAPK8

External database

human MAPK8

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB06089 pT7Cam_hsJNK1 Expression vector of human JNK1 coding sequence    
RDB06088 pEThsJNK1 Expression vector of human JNK1 coding sequence    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR444011 RBdS110A11 pGCAP10 NM_139046.4 Full done
GACGGCCCGCGTCTCTGTTACTCAGCCGAGCGGCCGAGGCCGGACGACGCGGCTTGGATT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.01

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl