Prev. |  KEGG KO K04345 > 

RIKEN DNA Bank Human Resource - PRKACA

Gene ID NCBI Gene 5566 |  KEGG hsa:5566
Gene Symbol PRKACA
Protein Name protein kinase cAMP-activated catalytic subunit alpha
Synonyms PKACA|PPNAD4
Ortholog resources KEGG ortholog (KEGG orthology K04345) in the DNA Bank
Featured content Hedgehog signaling (human)
Featured content Wnt signaling pathway (human)
Featured content Parkinson disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX033966 IRAK084P06 pCMV-SPORT6 BC039846 NM_002730 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006012 W01A015A12 pENTR-TOPO IRAK084P06 BC039846 NM_002730 done
HGE006016 W01A015A16 pENTR-TOPO IRAK084P06 BC039846 NM_002730  

♦ W series clone contains a stop codon.

GNP_entry_W01A_210404.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR247393 ARiS118I01 pGCAP10 NM_002730.3  
GCCGCCGCCGCGATGGGCAACGCCGCCGCCGCCAAGAAGGGCAGCGAGCAGGAGAGCGTG
HKR368004 RBd20A04 pGCAP10 NM_002730.3  
GGACGCGGGAAGCAGGGGCTGGGCGGGGGTCGCGGCGCCGCAGCTAGCGCAGCCAGCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl