Prev. |  KEGG KO K07198 > 

RIKEN DNA Bank Human Resource - PRKAA1

Gene ID NCBI Gene 5562 |  KEGG hsa:5562
Gene Symbol PRKAA1
Protein Name protein kinase AMP-activated catalytic subunit alpha 1
Synonyms AMPK|AMPKa1
Ortholog resources KEGG ortholog (KEGG orthology K07198) in the DNA Bank
Featured content Circadian clock (human)
Featured content Autophagy (human)
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY019008 IRAK047I16 pBluescriptR BC037303 NM_006251 Full
HGY042556 IRAK106G12 pBluescript BC048980 NM_206907 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR181610 ARi54A10 pGCAP10 NM_006251.5  
GAGAAAGATGGCGACAGCCGAGAAGCAGAAACACGACGGGCGGGTGAAGATCGGCCACTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.02.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl