Prev. |  KEGG KO K13910 > 

RIKEN DNA Bank Human Resource - PRH1

Gene ID NCBI Gene 5554 |  KEGG hsa:5554
Gene Symbol PRH1
Protein Name proline rich protein HaeIII subfamily 1
Synonyms Db-s|PA|PIF-S|PRH2|Pr1/Pr2
Ortholog resources KEGG ortholog (KEGG orthology K13910) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY019259 IRAK048C11 pBluescriptR BC031043 NM_006250 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE080848 M01C002B24 pDONR221 04-134-2_1-H12 BC064553 NM_006250  
HGE080896 M01C002D24 pDONR221 04-134-2_1-H12 BC064553 NM_006250  
HGE080944 M01C002F24 pDONR221 04-134-2_1-H12 BC064553 NM_006250  
HGE080992 M01C002H24 pDONR221 04-134-2_1-H12 BC064553 NM_006250  
HGE081040 M01C002J24 pDONR221 04-134-2_1-H12 BC064553 NM_006250  
HGE081088 M01C002L24 pDONR221 04-134-2_1-H12 BC064553 NM_006250  
HGE081136 M01C002N24 pDONR221 04-134-2_1-H12 BC064553 NM_006250  
HGE081184 M01C002P24 pDONR221 04-134-2_1-H12 BC064553 NM_006250  
HGE096007 M01C040A07 pDONR221 MGC09-E04 BC064553 NM_006250  
HGE096055 M01C040C07 pDONR221 MGC09-E04 BC064553 NM_006250  
HGE096103 M01C040E07 pDONR221 MGC09-E04 BC064553 NM_006250  
HGE096151 M01C040G07 pDONR221 MGC09-E04 BC064553 NM_006250  
HGE096199 M01C040I07 pDONR221 MGC09-E04 BC064553 NM_006250  
HGE096247 M01C040K07 pDONR221 MGC09-E04 BC064553 NM_006250  
HGE096295 M01C040M07 pDONR221 MGC09-E04 BC064553 NM_006250  
HGE096343 M01C040O07 pDONR221 MGC09-E04 BC064553 NM_006250  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR028032 ARa70B08 pKA1U5 NM_006250.2  
GAGTCGGCCATCATGCTGGCCCCGGAGGCCGTTATCTTAGTCATGGCTCTAAATATGTAC
HKR392946 RBd82G02 pGCAP10 NM_006250.2  
GAACGGACCCTGGGAGTCGGCCATCATGCTGGCCCCGGAGGCCGTTATCTTAGTCATGGC
HKR433286 RBdS083D14 pGCAP10 NM_006250.2  
GGTCGGCCATCATGCTGGCCCCGGAGGCCGTTAGCTTAGTCATGGCTCTAAATATGTACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl