Prev. |  KEGG KO K04460 > 

RIKEN DNA Bank Human Resource - PPP5C

Gene ID NCBI Gene 5536 |  KEGG hsa:5536
Gene Symbol PPP5C
Protein Name protein phosphatase 5 catalytic subunit
Synonyms PP5|PPP5|PPT
Ortholog resource in our bank

  PPP5C

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001614 IRAK004A14 pCMV-SPORT6 BC001970 NM_006247
HGY081116 IRAL002N04 pOTB7 BC000750 NM_006247 Partial/var
HGY084119 IRAL010E23 pOTB7 BC001831 NM_006247 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE002329 W01A005N17 pENTR-TOPO IRAK004A14 BC001970 NM_006247  
HGE002331 W01A005N19 pENTR-TOPO IRAK004A14 BC001970 NM_006247  
HGE002333 W01A005N21 pENTR-TOPO IRAK004A14 BC001970 NM_006247  
HGE002335 W01A005N23 pENTR-TOPO IRAK004A14 BC001970 NM_006247  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR320574 RBb01H06 pKA1U5 NM_006247.2  
HKR371354 RBd28G10 pGCAP10 NM_006247.2  
GGCTTTGCGGCATGGCGATGGCGGAGGGCGAGAGGACTGAGTGTGCTGAGCCCCCCCGGG
HKR405938 RBdS014O02 pGCAP10 NM_006247.2  
GGCGGCGCTCCTTCGCGACGGTTCGGCCGGGTGCCGCTGGCGGCCGTTGCCAGGGTAGGG
HKR470836 RBdS177B12 pGCAP10 NM_006247.2  
GAGGGTAGGGGTCGCTTTGCGGCATGGCGATGGCGGAGGGCGAGAGGACTGAGTGTGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl