DNA Bank Top |  KEGG KO K04348 > 

RIKEN DNA Bank Human Resource - PPP3CB

Gene ID NCBI Gene 5532 |  KEGG hsa:5532
Gene Symbol PPP3CB
Protein Name protein phosphatase 3 catalytic subunit beta
Synonyms CALNA2|CALNB|CNA2|PP2Bbeta
Featured content Wnt signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content Axon guidance - human
Featured content Alzheimer disease - human
Featured content Amyotrophic lateral sclerosis (ALS) - human

Link

Ortholog resource in our bank

  PPP3CB


External database

human PPP3CB

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB19404 pCAG-hPPP3CB-FLAG Expression vector of human PPP3CB with FLAG-tag.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX024850 IRAK062C02 pCMV-SPORT6 BC028049 NM_021132 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE002691 W01A006M03 pENTR-TOPO IRAK062C02 BC028049 NM_021132  
HGE002693 W01A006M05 pENTR-TOPO IRAK062C02 BC028049 NM_021132  
HGE002695 W01A006M07 pENTR-TOPO IRAK062C02 BC028049 NM_021132  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR368826 RBd22B02 pGCAP10 NM_021132.1  
GAGAGCCTAGCCGAGCCCCGGGCCCAGCATGGCCGCCCCGGAGCCGGCCCGGGCTGCACC
HKR385329 RBd63F09 pGCAP10 NM_021132.1  
GGTAGGGAAAGAGGGTCCGCCATGTTCCCCGGCGGCGCCGCCGCTTGGCTCTGGTAGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2025.03.28

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl