Prev. |  KEGG KO K03456 > 

RIKEN DNA Bank Human Resource - PPP2R1B

Gene ID NCBI Gene 5519 |  KEGG hsa:5519
Gene Symbol PPP2R1B
Protein Name protein phosphatase 2 scaffold subunit Abeta
Synonyms PP2A-Abeta|PR65B
Featured content Hippo signaling (human)
Featured content Sphingolipid signaling pathway (human)
Ortholog resource in our bank

  PPP2R1B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013830 IRAK034J14 pBluescriptR BC027596 NM_181699 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE039025 W01A097J09 pENTR-TOPO IRAK034J14 BC027596 NM_181699  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR076858 ARe92C10 pKA1U5 NM_002716.4  
GAGTAACCTTGCTTCGGACCCCCTGAGGCGTCCGCCCGGAGCCTTGCCCTTCCCGGGCGG
HKR219780 ARiS049H12 pGCAP10 NM_002716.4  
TGGAGAAAGAACATGGCGGGCGCATCAGAGCTCGGGACCGGCCCAGGAGCAGCGGGTGGA
HKR462643 RBdS156K03 pGCAP10 NM_002716.4  
GGGGGCGGGAGGCGGTGACCAGCAGCAGGAGGAGAAAGAACATGGCGGGCGCATCAGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl