DNA Bank Top |  KEGG KO K04382 > 

RIKEN DNA Bank Human Resource - PPP2CA

Gene ID NCBI Gene 5515 |  KEGG hsa:5515
Gene Symbol PPP2CA
Protein Name protein phosphatase 2 catalytic subunit alpha
Synonyms NEDLBA|PP2Ac|PP2CA|PP2Calpha|RP-C
Featured content Hippo signaling (human)
Featured content Sphingolipid signaling pathway (human)

Link

Ortholog resource in our bank

  PPP2CA


External database

human PPP2CA

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB14398 pCIneoFHF-PP2A Expression vector of FLAG-His6-FLAG-tagged human PP2A.    
RDB05926 pAxCALNLhPPP2CA (reverse) Shuttle vector to generate rAd harboring human PPP2CA (reverse)    
RDB05925 pAxCALNLhPPP2CA (forward) Shuttle vector to generate rAd harboring human PPP2CA (forward)    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020941 IRAK052F21 pCMV-SPORT6 BC031696 NM_002715 Full
HGY080612 IRAL001I20 pOTB7 BC000400 NM_002715 Full
HGY083689 IRAL009D17 pOTB7 BC019275 NM_002715 Full
HGY084953 IRAL012G09 pOTB7 BC002657 NM_002715 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001393 W01A003I01 pENTR-TOPO IRAL012G09 BC002657 NM_002715  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR339300 RBb48E04 pGCAP1 NM_002715.2  
AATGTGCTCTGGAGCCTCAGCGAGCGGAGGAGGAGGCGCAGCGGCCGACGGCCGAGTACT
HKR342949 RBb57G05 pGCAP1 NM_002715.2  
GGTCACCACGCCCGGCGGCCGCCATTACAGAGAGCCGAGCTCTGGAGCCTCAGCGAGCGG
HKR372003 RBd30A03 pGCAP10 NM_002715.2  
GACCACGCCCGGCGGCCGCCATTACAGAGAGCCGAGCTCTGGAGCCTCAGCGAGCGGAGG
HKR378547 RBd46G03 pGCAP10 NM_002715.2  
GGGCCGCCATTACAGAGAGCCGAGCTCTGGAGCCTCAGCGAGCGGAGGAGGAGGCGCAGC
HKR409166 RBdS022P06 pGCAP10 NM_002715.2  
GACCCCGCCCTCCGGGAGCCACGCCCAAAAAGTCAAGGCGCTTCAGTTACCAGCCGGCTA
HKR416169 RBdS040H01 pGCAP10 NM_002715.2  
GGGAGCCTCAGCGAGCGGAGGAGGAGGCGCAGCGGCCGACGGCCGAGTACTGCGGTGAGA
HKR420590 RBdS051H22 pGCAP10 NM_002715.2  
GGTGCGGCCGCCCGGGGAGGGCTCTGCAGTTGCGCAGCTTGCTCCCCGGCCCTTTTCCCC
HKR432544 RBdS081F24 pGCAP10 NM_002715.2  
GAGAGAGCCGAGCTCTGGAGCCTCAGCGAGCGGAGGAGGAGGCGCAGCGGCCGACGGCCG
HKR441670 RBdS104C22 pGCAP10 NM_002715.2  
GGGCCGCCATTACAGAGAGCCGAGCTCTGGAGCCTCAGCGAGCGGAGGAGGAGGCGCAGC
HKR452810 RBdS132A10 pGCAP10 NM_002715.2  
GACCACGCCCGGCGGCCGCCATTACAGAGAGCCGAGCTCTGGAGCCTCAGCGAGCGGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.09.29

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl