Prev. |  KEGG KO K06269 > 

RIKEN DNA Bank Human Resource - PPP1CC

Gene ID NCBI Gene 5501 |  KEGG hsa:5501
Gene Symbol PPP1CC
Protein Name protein phosphatase 1 catalytic subunit gamma
Synonyms PP-1G|PP1C|PPP1G
Featured content Hippo signaling (human)
Ortholog resource in our bank

  PPP1CC

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091388 IRAL028H20 pOTB7 BC014073 NM_002710 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR178875 ARi47D03 pGCAP10 NM_002710.2  
GCGAGGCTGTCTAAGGAGTCGGCGGCCATTTTGTTCTTCTCGTGGTTCCAGTGGGGAGAG
HKR390432 RBd76B08 pGCAP10 NM_002710.2  
GCTCGTGNTTCCAGTGGGGAGAGAAGGAGGAAGTAGGGAGCGGGGTGNCAGGGGGGGGAC
HKR396051 RBd90C03 pGCAP10 NM_002710.2  
GCTCGTGGTTCCAGTGGGGAGAGAAGGAGGAAGTAGGGAGCGGGGTGGCAGGGGGGGGAC
HKR416271 RBdS040L07 pGCAP10 NM_002710.2  
CGGCCGGCCGATGTCGTGGTTCCAGTGGGGAGAGAAGGAGGAAGTAGGGAGCGGGGTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl