Prev. |  KEGG KO K06269 > 

RIKEN DNA Bank Human Resource - PPP1CB

Gene ID NCBI Gene 5500 |  KEGG hsa:5500
Gene Symbol PPP1CB
Protein Name protein phosphatase 1 catalytic subunit beta
Synonyms HEL-S-80p|MP|NSLH2|PP-1B|PP1B|PP1beta|PP1c|PPP1CD|PPP1beta
Featured content Hippo signaling (human)
Ortholog resource in our bank

  PPP1CB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085149 IRAL012O13 pOTB7 BC002697 NM_206877 Partial/var
HGY085218 IRAL013A18 pOTB7 BC012045 NM_206877 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234097 ARiS085E01 pGCAP10 NM_002709.2  
GGCGGAGCTGGGCGGTGCCGAGGAGGAGGAGGTGGCGGCCTGGGTCTGACGCGGCCCTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl