Prev. |  KEGG KO K00231 > 

RIKEN DNA Bank Human Resource - PPOX

Gene ID NCBI Gene 5498 |  KEGG hsa:5498
Gene Symbol PPOX
Protein Name protoporphyrinogen oxidase
Synonyms PPO|V290M|VP
Ortholog resources KEGG ortholog (KEGG orthology K00231) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE015414 W01A038I22 pENTR-TOPO IRAL001G20 BC002357 NM_000309 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR070832 ARe77B08 pKA1U5 NM_000309.3  
GGTAGCGGATTTGAAGCACTTGCTTGGCCTACACNNTTTNATGGCAAGCAGAGCACCTCA
HKR218169 ARiS045H01 pGCAP10 NM_000309.3  
GCGATAGCGAGGGTGTGGCCCTTATCTGCACCCAGCAGAGCGCCGGCGGGGTACGGTCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl