Prev. |  KEGG KO K17499 > 

RIKEN DNA Bank Human Resource - PPM1G

Gene ID NCBI Gene 5496 |  KEGG hsa:5496
Gene Symbol PPM1G
Protein Name protein phosphatase, Mg2+/Mn2+ dependent 1G
Synonyms PP2CG|PP2CGAMMA|PPP2CG
Ortholog resources KEGG ortholog (KEGG orthology K17499) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083023 IRAL007J07 pOTB7 BC000057 NM_177983 Full
HGY081245 IRAL003B21 pOTB7 BC022061 NM_177983 Full
HGY089767 IRAL024G23 pOTB7 BC007361 NM_177983 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR276773 ARiS191P13 pGCAP10 NM_177983.1  
GTTCCGCTCCCTCACAGCTCCCGTCCCGTTACCGCCTCCTGGCCGGCCTCGCGCCTTTCA
HKR322451 RBb06C03 pKA1U5 NM_177983.1  
GTCCCGTCCCGTTACCGCCTCCTGGCCGGCCTCGCGCCTTTCACCGGCACCTTGCGTCGG
HKR343657 RBb59C09 pGCAP1 NM_177983.1  
GGTCCCGTTACCGCCTCCTGGCCGGCCTCGCGCCTTTCACCGGCACCTTGCGTCGGTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl