Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CTSA

Gene ID (NCBI) 5476
Gene Symbol CTSA
Protein Name cathepsin A
Synonyms GLB2|GSL|NGBE|PPCA|PPGB
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Lysosome (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082058 IRAL005C10 pOTB7 BC000597 NM_000308 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE025360 W01A063G16 pENTR-TOPO IRAL005C10 BC000597 NM_000308  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041201 ARe03A01 pKA1U5 NM_000308.2  
GCAGTCCCCGGGCGCCTCCTGGAGAGCAAGGACGCGGGGGAGCAGAGATGATCCGAGCCG
HKR043304 ARe08E08 pKA1U5 NM_000308.2  
GAGTCCCCGGGCGCCTCCTGGAGAGCAAGGACGCGGGGGAGCAGAGATGATCCGAGCCGC
HKR061682 ARe54D10 pKA1U5 NM_000308.2  
NNCCTCGNNGNCTNACGCTTTCCNACNTGGTGTTTCATGCNTCTTTCGTTGGTAGGTTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.11.19

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl