Prev. |  KEGG KO K00764 > 

RIKEN DNA Bank Human Resource - PPAT

Gene ID NCBI Gene 5471 |  KEGG hsa:5471
Gene Symbol PPAT
Protein Name phosphoribosyl pyrophosphate amidotransferase
Synonyms ATASE|GPAT|PRAT
Ortholog resources KEGG ortholog (KEGG orthology K00764) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01642 Human amidophosphoribosyltransferase Human glutamine PRPP amidotransferase cDNA
RDB02326 pAxCAhAMPRTF (forward) Shuttle vector to produce rAd expressing human AMPRTF
RDB02753 AxCAhAMPRTF (forward) Recombinant adenovirus harboring human amidophosphoribosyltransferase cDNA

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084443 IRAL011B19 pOTB7 BC004200 NM_002703 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR392176 RBd80H08 pGCAP10 NM_002703.3  
GAGTAGCTGGGGCCACCCTCGGGAAGGAAGAGCCTGTCGCGAGCGCGAGCTTCTGAGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl