Prev. |  KEGG KO K03007 > 

RIKEN DNA Bank Human Resource - POLR2L

Gene ID NCBI Gene 5441 |  KEGG hsa:5441
Gene Symbol POLR2L
Protein Name RNA polymerase II subunit L
Synonyms RBP10|RPABC5|RPB10|RPB10beta|RPB7.6|hRPB7.6
Ortholog resources KEGG ortholog (KEGG orthology K03007) in the DNA Bank
Featured content Huntington disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080904 IRAL002E08 pOTB7 BC018649 NM_021128 Full
HGY088693 IRAL021M05 pDNR-LIB BC005903 NM_021128 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE038620 W01A096J04 pENTR-TOPO IRAL021M05 BC005903 NM_021128  
HGE047430 W01A118J14 pENTR-TOPO IRAL021M05 BC005903 NM_021128  
HGE047436 W01A118J20 pENTR-TOPO IRAL021M05 BC005903 NM_021128  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047631 ARe19B07 pKA1U5 NM_021128.4  
ATCCTGGAGTCTGGGACGCGCCGCCGCCATGATCATCCCTGCTACGCTTGCTTCACTTGT
HKR048006 ARe20A06 pKA1U5 NM_021128.4  
GAGTCTGGGACGCGCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGTGGCAAGAT
HKR062156 ARe55G12 pKA1U5 NM_021128.4  
GAGTCTGGGACGCGCCGCCGCCATGATCATCCCTGTTACGCTGCTTCACGTTGTGGCAAG
HKR178929 ARi47F09 pGCAP10 NM_021128.4  
GAGTCTGGGACGCGCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGTGGCAAGAT
HKR180505 ARi51E09 pGCAP10 NM_021128.4  
GAGTCTGGGACGCGCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGTGGCAAGAT
HKR182850 ARi57C02 pGCAP10 NM_021128.4  
GAGTCTGGGACGCGCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGTGGCAAGAT
HKR209551 ARiS023O15 pGCAP10 NM_021128.4  
GAGTCTGGGACGCGCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGTGGCAAGAT
HKR234082 ARiS085D10 pGCAP10 NM_021128.4  
GAGTCTGGGACGCGCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGTGGCAAGAT
HKR260103 ARiS150E07 pGCAP10 NM_021128.4  
GAGTCTGGGACGCGCCNCCGCCATGATCATCCCTGTACGCTGCTTCACTTGTGGCAAGAT
HKR264647 ARiS161K07 pGCAP10 NM_021128.4  
GAGTCTGGGACGCGCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGTGGCAAGAT
HKR277816 ARiS194I24 pGCAP10 NM_021128.4  
GTCGCGGAGTCTGGGACGCGCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGTGG
HKR279218 ARiS198A18 pGCAP10 NM_021128.4  
HKR327774 RBb19H06 pKA1U5 NM_021128.4  
GAGTCTGGGACGCGCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGTGGCAAGAT
HKR362949 RBd07G05 pGCAP10 NM_021128.4  
GGGTTCTTCGCGTGCGGCCGGGCCGGGCCGGGCAGTCTGGGACGCGCCGCCGCCATGATC
HKR372480 RBd31D08 pGCAP10 NM_021128.4  
GAGTCTGGGACGCGCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGTGGCAAGAT
HKR388131 RBd70F11 pGCAP10 NM_021128.4  
GAGTCTGGGACGCGCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGTGGCAAGAT
HKR403078 RBdS007L14 pGCAP10 NM_021128.4  
GAGTCTGGGACGCGCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGTGGCAAGAT
HKR461889 RBdS154M01 pGCAP10 NM_021128.4  
GAGTCTGGGGCGCGCCCCCNNCNNCNNCNNCCCTGTNCCCTGCTTCACNNGNGGCNGATC
HKR461913 RBdS154N01 pGCAP10 NM_021128.4  
GAGTCTGGGACGCGCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGTGGCAAGAT
HKR461937 RBdS154O01 pGCAP10 NM_021128.4  
GAGTCTGGGACGCGCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGTGGCAAGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl