Prev. |  KEGG KO K03017 > 

RIKEN DNA Bank Human Resource - POLR2I

Gene ID NCBI Gene 5438 |  KEGG hsa:5438
Gene Symbol POLR2I
Protein Name RNA polymerase II subunit I
Synonyms RPB9|hRPB14.5
Ortholog resources KEGG ortholog (KEGG orthology K03017) in the DNA Bank
Featured content Huntington disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067224 IRAK168A24 pBluescriptR BC067794 NM_006233 Full
HGY089543 IRAL023O07 pOTB7 BC017112 NM_006233 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000649 W01A001K09 pENTR-TOPO IRAL023O07 BC017112 NM_006233  
HGE000651 W01A001K11 pENTR-TOPO IRAL023O07 BC017112 NM_006233  
HGE000655 W01A001K15 pENTR-TOPO IRAL023O07 BC017112 NM_006233  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR055726 ARe39F06 pKA1U5 NM_006233.4  
GGCGCGGGCTGCGCGTCGCCATGGAGCCCGACGGGACTTACGAGCCGGGCTTCGTGGGTA
HKR208066 ARiS020C18 pGCAP10 NM_006233.4  
GGCGCATGCGCACTGGCCTTCAACCAAGCCAAGCGCCTTGGCTTCTGTCCTGGATGCTCA
HKR321354 RBb03G10 pKA1U5 NM_006233.4  
GGCGGGCTGCGCGTCGCCATGGAGCCCGACGGGACTTACGAGCCGGGCTTCGTGGGTATT
HKR329633 RBb24B09 pGCAP1 NM_006233.4  
GACTGGCCTTCAACCAAGCCAAGCGCCTTGGCTTCTGTCCTGGATGCTCAGTGTTTTGCG
HKR340503 RBb51E07 pGCAP1 NM_006233.4  
GGCGCGGGCTGCGCGTCGCCATGGAAGCCCGACGGGACTTACGAGCCGGGCTTCGTGGGT
HKR370403 RBd26A03 pGCAP10 NM_006233.4  
GAGCGCGGCGGAGCAAGCGCAGAAGGCTGGGAGGGCTGCGCGGGCTGCGCGTCGCCATGG
HKR379723 RBd49F03 pGCAP10 NM_006233.4  
GGAGGGCTGCGCGGGCTGCGCGTCGCCATGGAGCCCGACGGGACTTACGAGCCGGGCTTC
HKR393306 RBd83E10 pGCAP10 NM_006233.4  
GAGAAGGCTGGGAGGGCTGCGCGGGCTGCGCGTCGCCATGGAGCCCGACGGGACTTACGA
HKR398449 RBd96C01 pGCAP10 NM_006233.4  
GGGGCTGCGCGTCGCCATGGAGCCCGACGGGACTTACGAGCCGGGCTTCGTGGGTATTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl