Prev. |  KEGG KO K03016 > 

RIKEN DNA Bank Human Resource - POLR2H

Gene ID NCBI Gene 5437 |  KEGG hsa:5437
Gene Symbol POLR2H
Protein Name RNA polymerase II subunit H
Synonyms RPABC3|RPB17|RPB8
Featured content Huntington disease - human
Ortholog resource in our bank

  POLR2H

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083159 IRAL007O23 pOTB7 BC000739 NM_006232 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE019151 W01A047O15 pENTR-TOPO IRAL007O23 BC000739 NM_006232  
HGE019155 W01A047O19 pENTR-TOPO IRAL007O23 BC000739 NM_006232  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR365708 RBd14E12 pGCAP10 NM_006232.2  
GGCTTTTGGTTCTCTCCGGTCTTGTCCACGCTAGGGGGTGCACGTACTCCCAACTGTGGT
HKR405375 RBdS013H07 pGCAP10 NM_006232.2  
GAGGGGGTGCACGTACTCCCAACTGTGGTCGCGCTCTCACCCCTTCTGCTGCTCTCGTGG
HKR428177 RBdS070H09 pGCAP10 NM_006232.2  
GACTCTCGTCTGGCCGCCGCGCTTTCAGGAGGTGCTTTTGGTTCTCTCCGGTCTTGTCCA
HKR428182 RBdS070H14 pGCAP10 NM_006232.2  
GACTCTCGTCTGGCCGCCGCGCTTTCAGGAGGTGCTTTTGGTTCTCTCCGGTCTTGTCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl