Prev. |  KEGG KO K03015 > 

RIKEN DNA Bank Human Resource - POLR2G

Gene ID NCBI Gene 5436 |  KEGG hsa:5436
Gene Symbol POLR2G
Protein Name RNA polymerase II subunit G
Synonyms RPB19|RPB7|hRPB19|hsRPB7
Ortholog resources KEGG ortholog (KEGG orthology K03015) in the DNA Bank
Featured content Huntington disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046880 ARe17D08 pKA1U5 NM_002696.2  
GAAGTGTTTCCGGTGGATTCCCAGGGACTGTCGGAGGTGTGGACTCTGCCTGCCTACCTG
HKR054950 ARe37G06 pKA1U5 NM_002696.2  
AAGTGTTTCCGGTGGATTCCCAGGGACTGTCGGAGGTGTGGACTCTGCCTGCCTACCTGG
HKR164173 ARi10H05 pGCAP10 NM_002696.2  
GAAGTGTTTCCGGTGGATTCCCAGGGACTGTCGGAGGTGTGGACTCTGCCTGCCTACCTG
HKR170150 ARi25G06 pGCAP10 NM_002696.2  
AAGTGTTTCCGGTGGATTCCCAGGGACTGTCGGAGGTGTGGACTCTGCCTGCCTACCTGG
HKR219680 ARiS049D08 pGCAP10 NM_002696.2  
GCGGTGGATTCCCAGGGACTGTCGGAGGTGTGGACTCTGCCTGCCTACCTGGTCTGGGAA
HKR219856 ARiS049K16 pGCAP10 NM_002696.2  
GCGGTGGATTCCCAGGGACTGTCGGAGGTGTGGACTCTGCCTGCCTACCTGGTCTGGGAA
HKR376405 RBd41A05 pGCAP10 NM_002696.2  
GAAGTGTTTCCGGTGGATTCCCAGGGACTGTCGGAGGTGTGGACTCTGCCTGCCTACCTG
HKR433413 RBdS083I21 pGCAP10 NM_002696.2  
GATTCCCAGGGACTGTCGGAGGTGTGGACTCTGCCTGCCTACCTGGTCTGGGAAGATGTT
HKR441827 RBdS104J11 pGCAP10 NM_002696.2  
GAAGTGTTTCCGGTGGATTCCCAGGGACTGTCGGAGGTGTGGACTCTGCCTGCCTACCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl