Prev. |  KEGG KO K03014 > 

RIKEN DNA Bank Human Resource - POLR2F

Gene ID NCBI Gene 5435 |  KEGG hsa:5435
Gene Symbol POLR2F
Protein Name RNA polymerase II subunit F
Synonyms HRBP14.4|POLRF|RPABC14.4|RPABC2|RPB14.4|RPB6|RPC15
Ortholog resources KEGG ortholog (KEGG orthology K03014) in the DNA Bank
Featured content Huntington disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083430 IRAL008J14 pOTB7 BC003582 NM_021974 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE024547 W01A061G03 pENTR-TOPO IRAL008J14 BC003582 NM_021974  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046178 ARe15H10 pKA1U5 NM_021974.2  
ATCCTGGACAATTTTGATGGCGACGACTTTGATGATGTGGAGGAGGATGAAGGGCTAGAT
HKR348908 RBb72E12 pGCAP1 NM_021974.2  
GGTAGTGTCGCTGTTTGCGGGTCTCCGCGCGGGACCGGGGCGCAGCGGGGTCGCTGAGGC
HKR384883 RBd62D11 pGCAP10 NM_021974.2  
GATAAGCTAGGAGCCGCGCGAGTCGTAGTGTCGCTGTTTGCGGGTCTCCGCGCGGGACCG
HKR420773 RBdS051P13 pGCAP10 NM_021974.2  
GAAGCTAGGAGCCGCGCGAGTCGTAGTGTCGCTGTTTGCGGGTCTCCGCGCGGGACCGGG
HKR428096 RBdS070D24 pGCAP10 NM_021974.2  
GGGGTTACGGCGCAGGCGCAAGATAAGCTAGGAGCCGCGCGAGTCGTAGTGTCGCTGTTT
HKR442307 RBdS105M19 pGCAP10 NM_021974.2  
GCGCGCGAGTCGTAGTGTCGCTGTTTGCGGGTCTCCGCGCGGGACCGGGGCGCAGCGGGG
HKR444221 RBdS110J05 pGCAP10 NM_021974.2  
GAGGAGCCGCGCGAGTCGTAGTGTCGCTGTTTGCGGGTCTCCGCGCGGGACCGGGGCGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl