Prev. |  KEGG KO K03013 > 

RIKEN DNA Bank Human Resource - POLR2E

Gene ID NCBI Gene 5434 |  KEGG hsa:5434
Gene Symbol POLR2E
Protein Name RNA polymerase II subunit E
Synonyms RPABC1|RPB5|XAP4|hRPB25|hsRPB5
Ortholog resources KEGG ortholog (KEGG orthology K03013) in the DNA Bank
Featured content Huntington disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083953 IRAL009O17 pOTB7 BC004441 NM_002695 Full
HGY096559 IRAL041G15 pDNR-LIB BC034144 NM_002695 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE019000 W01A047I08 pENTR-TOPO IRAL009O17 BC004441 NM_002695  
HGE019002 W01A047I10 pENTR-TOPO IRAL009O17 BC004441 NM_002695  
HGE019006 W01A047I14 pENTR-TOPO IRAL009O17 BC004441 NM_002695  
HGE019016 W01A047I24 pENTR-TOPO IRAL009O17 BC004441 NM_002695  
HGE019042 W01A047K02 pENTR-TOPO IRAL009O17 BC004441 NM_002695  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR182435 ARi56B11 pGCAP10 NM_002695.3  
GAGGCGCAGTCCGCGCGGGTTCTCGCGCGGAGAAGGGGTGCGAGCAGCGGCGGCGGCGGA
HKR205528 ARiS013N16 pGCAP10 NM_002695.3  
GGCGCGGAGAAGGGGTGCGAGCAGCGGCGGCGGCGGAGGCTGCCATGGACGACGAGGAGG
HKR322084 RBb05D12 pKA1U5 NM_002695.3  
GAGTCCGCGCGGGTTCTCGCACGCAGAAGGGGTGCGAGCGGCGGCGGCGGCGGAGGCTGC
HKR334972 RBb37H04 pGCAP1 NM_002695.3  
AGAAGGGGTGCGAGCGGCGGCGGCGGCGGAGGCTGCCATGGACGACGAGGAGGAGACGTA
HKR340976 RBb52H08 pGCAP1 NM_002695.3  
GCCGCGCGGGTTCTCGCACGCAGAAGGGGTGCGAGCGGCGGCGGCGGCGGAGGCTGCCAT
HKR362902 RBd07E06 pGCAP10 NM_002695.3  
GAGAAGGGGTGCGAGCGGCGGCGGCGGCGGAGGCTGCCATGGACGACGAGGAGGAGACGT
HKR388569 RBd71H01 pGCAP10 NM_002695.3  
GGCGCGGGTTCTCGCACGCAGAAGGGGTGCGAGCGGCGGCGGCGGCGGAGGCTGCCATGG
HKR388835 RBd72B11 pGCAP10 NM_002695.3  
GACGCAGAAGGGGTGCGAGCGGCGGCGGCGGCGGAGGCTGCCATGGACGACGAGGAGGAG
HKR405279 RBdS013D07 pGCAP10 NM_002695.3  
GGCGGCGGCGGCGGCNGAGGCTGCCATGGACGACGAGGAGGAGACGTACCGGCTCTGGAA
HKR405662 RBdS014C14 pGCAP10 NM_002695.3  
GGAAGGGGTGCGAGCGGCGGCGGCGGCGGAGGCTGCCATGGACGACGAGGAGGAGACGTA
HKR444284 RBdS110L20 pGCAP10 NM_002695.3  
GGCACGCAGAAGGGGTGCGAGCGGCGGCGGCGGCGGAGGCTGCCATGGACGACGAGGAGG
HKR461819 RBdS154J03 pGCAP10 NM_002695.3  
GGCGCGGGTTCTCGCACGCAGAAGGGGTGCGAGCGGCGGCGGCGGCGGAGGCTGCCATGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl